0
What else can I help you with?
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
What is the order of bases in the second strand of the DNA molecule?
The order of bases in the second strand of a DNA molecule is complementary to the first strand, following the base pairing rules (A with T, C with G). So, if the first strand has the sequence ATCG, the second strand would have the sequence TAGC.
What bases would match up to form a matching DNA strand from this pattern?
A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.
A protein contains 131 amino acids How many bases will there be on the mRNA strand corresponding to these amino acids and how do you know?
There would be 393 bases on the mRNA strand corresponding to 131 amino acids, as each amino acid is coded for by a sequence of three bases (1 codon). By multiplying the number of amino acids by 3, you can determine the total number of bases required to encode the protein sequence on mRNA.
If the base sequence on one DNA strand is ATGGCCTAG what is the sequence on the strand of the helix?
The sequence on the strand of the helix is TACCGGATC.
What is a matching strand of DNA compared to AGTAAC?
A matching strand of DNA to the sequence AGTAAC would be its complementary strand, which consists of the bases that pair with each nucleotide. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary strand to AGTAAC would be TCATTG.
If the sequence of bases in one DNA strand is TAG then the sequence of bases in the other strand will be?
The corresponding mRNA strand would be AUCG.
How would the bases of the complementary strand read?
The complementary sequence of a DNA strand is written with the beginning letters of the bases: adenine (A), cytosine (C), guanine (G), and thymine (T). You would replace each letter with its complementary nucleotide. Replace: A for T T for A C for G G for C
What would be the complimentary sequence of bases produced by a DNA strand with bases CTGCCA?
The sequence would be GACGGT
What is the order of bases in the second strand of the DNA molecule?
The order of bases in the second strand of a DNA molecule is complementary to the first strand, following the base pairing rules (A with T, C with G). So, if the first strand has the sequence ATCG, the second strand would have the sequence TAGC.
During DNA replication a DNA strand has the bases Write the matching rna strand DNA ctagctagtctagtcctgatac RNA?
gaucgaucacucaggacuaug
A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?
The complimentary strand of MRNA would be AAUUCCGG.
What bases would match up to form a matching DNA strand from this pattern?
A pairs with T, C pairs with G. So the matching bases for a DNA strand with the pattern GATC would be CTAG.
What is the sequeance of the bases on the opposite strand?
The opposite strand in DNA will have bases that pair with the original strand according to the base pairing rules: adenine with thymine and cytosine with guanine. So, if the original sequence is ATCG, the opposite strand will be TAGC.
If the sequence of nucleotides of one strand of the two strands of DNA was known is it possible to use that information to determine the sequence of the second strand?
Yes because the bases pair uniquely when the strands are joined together.
A protein contains 131 amino acids How many bases will there be on the mRNA strand corresponding to these amino acids and how do you know?
There would be 393 bases on the mRNA strand corresponding to 131 amino acids, as each amino acid is coded for by a sequence of three bases (1 codon). By multiplying the number of amino acids by 3, you can determine the total number of bases required to encode the protein sequence on mRNA.
What determines the nitrogen base sequence of a DNA in a new strand of DNA?
Since A pairs with T, and G pairs with C, then the sequence of bases in the strand of DNA being copied determines the sequence of bases in the newly copied strand. The bases are complementary (A gives T and G gives C when copied).
