A pairs only with T, and C pairs only with G. You know this is DNA (instead of RNA) because it has T instead of U.
A = Adenine, T = Thymine, C = Cytosine, and G = Guanine
An example:
One strand: CGATCCGA
Complimentary: GCTAGGCT
Now you know enough to solve the problem on your own.
The complementary strand for ATTGCGT would be TAACGCA. This is because adenine pairs with thymine and guanine pairs with cytosine in DNA strands.
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
taacgggtac
B. Complimentary
The complementary strand for ATTGCGT would be TAACGCA. This is because adenine pairs with thymine and guanine pairs with cytosine in DNA strands.
AATCGCCGTTA
It would be ATCAGT. A=T T=A G=C C=G for all the DNA sequences the complementary strand would be the opposite.
3' aatgcccaggtcagtacgct 5' is the complimentary strand.
acg-att
The complimentary DNA strand would be AGCTCTTAGAGCTAA.
taacgggtac
B. Complimentary
It will be ttaaccgg because adenine pairs with thymine and guanine with cytocine.
lol i hate this question........its in meh science book
The complementary strand for bases AAGCCA would be TTCGGT. In DNA, adenine pairs with thymine and guanine pairs with cytosine.
The complimentary strand of MRNA would be AAUUCCGG.