0
The correct base-pairing rules ofr DNA. . .
The base pairing rules for DNA are
- A pairs with T
- G pairs with C
- C pairs with G
- T pairs with A
Wiki User
∙ 12y ago
Wiki User
∙ 12y agoAdenine--thymine; guanine--cytosine.
Add your answer:
Earn +20 pts
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
ctgtagcaactgatgccgactag
Explain how Chargaff rules helped Watson and Crick model Dna?
How
Where can one test a dog's DNA?
Yes there is no difference the same rules aply to all animals
What is the common name of Fluoride?
The correct name, after the IUPAC rules, is hafnium tetrafluoride (HfF4).
Using the rules for selecting symbols for the elements what could NOT be a correct symbol for a chemical element?
CH
What basepairing is found in DNA and RNA?
The Complementary base pairing of DNA is A with T and C with G. In Rna, T is replaced with U.
What are the correct base-pairing rules for DNA?
adenine bonds to thymine and guanine bonds to cytosine
What are the correct base pairing rules of the DNA?
Adenine pairs with thymine, and cytosine pairs with guanine.
DNA methylation in prokaryotes?
what is the rules of methylation in transduction
New DNA is replicated in strands complementary to old DNA becaise production of new DNA follows the rules of?
base pairing
New DNA is replicated in strands complementary to old DNA because production of new DNA follows the rules of?
base pairing
What statement is correct regarding the cells and DNA?
all the cells have identical DNA
How are base pairing rules and complementary base pairs related?
Base pairing rules and complementary base rules are related because of DNA. If one can find the base pairing on a strand of DNA, usually the complementary base is easily found.
Is it grammatically correct to say will abide to the rules?
No, you abide by the rules.
Is it right to say 'rules will follow'?
Yes, "Rules will follow." is correct.
What is the correct spelling of DNA?
The letters DNA stand for the genetic material "deoxyribonucleic acid."
Is the chromosome a part of a DNA or is a DNA a part of a chromosome?
The second statement would be more correct.
