answersLogoWhite

0

The correct complementary base pairs in DNA are adenine (A) with thymine (T), and cytosine (C) with guanine (G).

User Avatar

AnswerBot

10mo ago

What else can I help you with?

Related Questions

What are the complementary base pairs in DNA?

The complementary base pairs in DNA are adenine (A) with thymine (T), and cytosine (C) with guanine (G).


What are the correct base-pairing rules of DNA?

The correct base-pairing rules in DNA are adenine (A) pairing with thymine (T) and guanine (G) pairing with cytosine (C). This forms complementary base pairs that contribute to the double-helix structure of DNA.


What is CCGTAGGCC?

CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).


What is the complementary DNA base sequence for the following bases AACT?

The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.


What are the correct base pairing rules of the DNA?

The correct base pairing rules in DNA are adenine (A) pairing with thymine (T) and cytosine (C) pairing with guanine (G). This forms the complementary base pairs that make up the double helix structure of DNA.


In a DNA molecule what base sequence is complementary to the sequence CGAC?

The base sequence complementary to CGAC in a DNA molecule is GCTG. In DNA, cytosine (C) pairs with guanine (G), and adenine (A) pairs with thymine (T), so you would replace each base with its complementary counterpart. Therefore, C pairs with G, G pairs with C, A pairs with T, and C pairs with G.


What is the enzyme responsible for reading the DNA template and adding complementary base pairs during the process of DNA replication?

The enzyme responsible for reading the DNA template and adding complementary base pairs during DNA replication is called DNA polymerase.


A gene has the base sequence that starts with TCG GAC CAT CGA a) What would be the complementary DNA strand formed from this DNA ing?

The complementary DNA strand would be AGC CTG GTA GCT. In DNA, adenine pairs with thymine and cytosine pairs with guanine. Therefore, the complementary strand is formed by replacing each base with its complementary base.


If the base sequence on a separated DNA strand is CGTAGG what will the base sequence on its complementary strand be?

The base sequence on the complementary DNA strand will be GCATCC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, for each base in the original sequence CGTAGG, the complementary bases are as follows: C pairs with G, G pairs with C, T pairs with A, A pairs with T, G pairs with C, and G pairs with C again.


What are base pairs in biotechnology?

In biotechnology, base pairs refer to the complementary pairing of nitrogenous bases in DNA molecules. Adenine pairs with thymine, and guanine pairs with cytosine. Understanding base pairs is crucial for techniques like PCR and DNA sequencing.


How are base pairing rules and complementary base pairs related?

Base pairing rules dictate that in DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). These pairs are called complementary base pairs because they always bond together due to their specific chemical structures and hydrogen bonding capabilities. Together, these rules ensure the accurate replication and transcription of DNA.


What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?

The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.