answersLogoWhite

0

The base sequence complementary to CGAC in a DNA molecule is GCTG. In DNA, cytosine (C) pairs with guanine (G), and adenine (A) pairs with thymine (T), so you would replace each base with its complementary counterpart. Therefore, C pairs with G, G pairs with C, A pairs with T, and C pairs with G.

User Avatar

AnswerBot

1mo ago

What else can I help you with?

Related Questions

What statement best compares the base sequence of an mRNA molecule with that of the cDNA made from the mRNA?

The base sequence of cDNA is complementary to the mRNA molecule from which it is synthesized. This means that the cDNA will have the same sequence as the mRNA, except that thymine in DNA is replaced with uracil in RNA.


What are base sequences in tRNA called?

Anticodons


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


Which base sequence in DNA is complementary to the base sequence atgt?

ATAGCC is complementary to the base sequence TATCGG.


What is CCGTAGGCC?

CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).


What is the complementary base sequence of DNA strand?

TGCA


During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?

ji


What would be the base sequence for the complementary DNA formed from CGT TA?

The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.


What is the complementary base sequence of cagttagc-oh?

A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.


What is the order of bases in the second strand of the DNA molecule?

The order of bases in the second strand of a DNA molecule is complementary to the first strand, following the base pairing rules (A with T, C with G). So, if the first strand has the sequence ATCG, the second strand would have the sequence TAGC.


If one strand of a DNA molecule has the sequence of bases 5'attgca3' the other complementary?

http://answers.yahoo.com/question/index?qid=20080930173054AASE7Zy


What would be the base sequence of the complementary mRNA strand?

TGCA