answersLogoWhite

0

The base sequence complementary to CGAC in a DNA molecule is GCTG. In DNA, cytosine (C) pairs with guanine (G), and adenine (A) pairs with thymine (T), so you would replace each base with its complementary counterpart. Therefore, C pairs with G, G pairs with C, A pairs with T, and C pairs with G.

User Avatar

AnswerBot

4mo ago

What else can I help you with?

Related Questions

What statement best compares the base sequence of an mRNA molecule with that of the cDNA made from the mRNA?

The base sequence of cDNA is complementary to the mRNA molecule from which it is synthesized. This means that the cDNA will have the same sequence as the mRNA, except that thymine in DNA is replaced with uracil in RNA.


What are base sequences in tRNA called?

Anticodons


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What is the complementary DNA base sequence for the following bases AACT?

The complementary DNA base sequence for AACT is TTGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original sequence is replaced by its complementary base.


Which base sequence in DNA is complementary to the base sequence atgt?

ATAGCC is complementary to the base sequence TATCGG.


What is CCGTAGGCC?

CCGTAGGCC is a sequence of DNA base pairs. It represents the complementary DNA strand to the original sequence GGCTACGG, where each base pairs with its complementary base (A with T and C with G).


What is the complementary base sequence of DNA strand?

TGCA


What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?

The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.


What is the base sequence of the original DNA segment?

To determine the base sequence of the original DNA segment, you would need to know the complementary base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you have a sequence of the complementary DNA strand, you can reverse the pairs to identify the original sequence. Without the specific complementary sequence provided, the original DNA segment cannot be determined.


During DNA replication what sequence on complementary base pairs will be match to the following sequence ATACGCGTTA?

ji


What is the order of bases in the second strand of the DNA molecule?

The order of bases in the second strand of a DNA molecule is complementary to the first strand, following the base pairing rules (A with T, C with G). So, if the first strand has the sequence ATCG, the second strand would have the sequence TAGC.


What would be the base sequence for the complementary DNA formed from CGT TA?

The base sequence for the complementary DNA would be GCA AT. Since DNA strands are complementary, the bases pair as follows: A with T, T with A, C with G, and G with C.