answersLogoWhite

0

The base sequence on the complementary DNA strand will be GCATCC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, for each base in the original sequence CGTAGG, the complementary bases are as follows: C pairs with G, G pairs with C, T pairs with A, A pairs with T, G pairs with C, and G pairs with C again.

User Avatar

AnswerBot

8mo ago

What else can I help you with?

Continue Learning about Natural Sciences

What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?

The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.


What is the base sequence along the complementary region of the other strand of the double helix if one is GAATGC?

The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).


What can you predict the base sequence of one stand in a molecule of DNA if you know the sequence of the other strand?

If you know the sequence of one strand of a DNA molecule, you can predict the base sequence of the complementary strand based on base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the known strand has the sequence 5'-ATCG-3', the complementary strand would have the sequence 3'-TAGC-5'. This complementary relationship allows for the accurate prediction of one strand's sequence from the other.


If the sequence of nitrogenous bases is one standard of DNA is gta-gca the sequence of bases on its complementary DNA stand would be?

The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.


What is the sequence of the template strand if a nontenplate strand has the sequence 5'ATGGGCGC3'?

To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.

Related Questions

What sequence is the sequence of the complementary strand of DNA?

its tcaa


What is the sequence of complementary strand?

TGCA


What is the complementary base sequence of the DNA strand if the template strand reads TTGCACG?

The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.


Complementary dna sequence?

A complimentary DNA sequence is the genetic code on the partner strand that aligns with and corresponds to (matches) the code on the primary strand. Each nucleotide has a match, A matches T and C matches G, therefore the complimentary sequence for ATCGA is TAGCT.


What is the base sequence along the complementary region of the other strand of the double helix if one is GAATGC?

The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).


If the DNA sequence is TAG what is the sequence of the complementary strand of tRNA?

auc


What is the complementary base sequence of DNA strand?

TGCA


What can you predict the base sequence of one stand in a molecule of DNA if you know the sequence of the other strand?

If you know the sequence of one strand of a DNA molecule, you can predict the base sequence of the complementary strand based on base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the known strand has the sequence 5'-ATCG-3', the complementary strand would have the sequence 3'-TAGC-5'. This complementary relationship allows for the accurate prediction of one strand's sequence from the other.


What would be the base sequence of the complementary mRNA strand?

TGCA


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


If the sequence of nitrogenous bases is one standard of DNA is gta-gca the sequence of bases on its complementary DNA stand would be?

The complementary DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, if one strand has the sequence gta-gca, the complementary strand would have the sequence cat-cgt.


What is the sequence of the template strand if a nontenplate strand has the sequence 5'ATGGGCGC3'?

To determine the sequence of the template strand, you need to find the complementary bases to the nontemplate strand (5' ATGGGCGC 3'). The complementary bases are A-T and G-C. Therefore, the sequence of the template strand will be 3' TACCCGCG 5', written in the opposite direction to maintain the 5' to 3' orientation.