answersLogoWhite

0

Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.

User Avatar

Wiki User

14y ago

What else can I help you with?

Related Questions

Given the following strand of dna what is the complementary strand actggctac?

The complementary DNA strand to ACTGGCTAC is TGACCGATG.


What is complementary DNA strand for att-cga-tgc?

The complementary strand of the DNA is TAA-GCT-ACG


What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?

The template strand is used to make a complementary copy. This is a type of DNA strand.


What is the complementary DNA?

A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?


What is the complementary DNA strand of CCTAGCT?

GGATCGA is comlementary to the DNA strand CCTAGCT.


What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?

The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.


What complementary strand of DNA would be produced from the DNA strand cgt ta?

The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.


Which enzyme is responsible for adding complementary DNA bases to an exposed DNA strand?

The enzyme responsible for adding complementary DNA bases to an exposed DNA strand is DNA polymerase.


What is the complementary DNA strands?

A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?


What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?

The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.


When a strand of DNA is ATCG what would the complementary pairings be for the replicated strand of DNA?

TAGC.


Transcription makes a complementary strand of the DNA?

This Process Is Called DNA Transcription. *Apex*