Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
GGATCGA is comlementary to the DNA strand CCTAGCT.
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
To determine the complementary DNA strand, you would pair each base of the original DNA strand with its corresponding complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original strand is ATCG, the complementary strand would be TAGC. This base-pairing rule ensures that the two strands of DNA are complementary, allowing for proper replication and function.
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
The complementary strand of the DNA is TAA-GCT-ACG
The template strand is used to make a complementary copy. This is a type of DNA strand.
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
GGATCGA is comlementary to the DNA strand CCTAGCT.
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.
The enzyme responsible for adding complementary DNA bases to an exposed DNA strand is DNA polymerase.
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
TAGC.
This Process Is Called DNA Transcription. *Apex*