0
Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.
What else can I help you with?
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is the complementary DNA strand of CCTAGCT?
GGATCGA is comlementary to the DNA strand CCTAGCT.
What is the complementary DNA strands?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
If the strand of DNA were used what would be the complementary DNA produced?
To determine the complementary DNA strand, you would pair each base of the original DNA strand with its corresponding complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original strand is ATCG, the complementary strand would be TAGC. This base-pairing rule ensures that the two strands of DNA are complementary, allowing for proper replication and function.
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is complementary DNA strand for att-cga-tgc?
The complementary strand of the DNA is TAA-GCT-ACG
What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?
The template strand is used to make a complementary copy. This is a type of DNA strand.
What is the complementary DNA strand of CCTAGCT?
GGATCGA is comlementary to the DNA strand CCTAGCT.
What is the complementary DNA?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
Which enzyme is responsible for adding complementary DNA bases to an exposed DNA strand?
The enzyme responsible for adding complementary DNA bases to an exposed DNA strand is DNA polymerase.
What complementary strand of DNA would be produced from the DNA strand cgt ta?
The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.
What is the complementary DNA strands?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
When a strand of DNA is ATCG what would the complementary pairings be for the replicated strand of DNA?
TAGC.
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
Transcription makes a complementary strand of the DNA?
This Process Is Called DNA Transcription. *Apex*
