The complementary strand of the DNA is TAA-GCT-ACG
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
The template strand is used to make a complementary copy. This is a type of DNA strand.
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
GGATCGA is comlementary to the DNA strand CCTAGCT.
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.
The enzyme responsible for adding complementary DNA bases to an exposed DNA strand is DNA polymerase.
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
TAGC.
This Process Is Called DNA Transcription. *Apex*
The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.