answersLogoWhite

0

The complementary DNA strand to ACTGGCTAC is TGACCGATG.

User Avatar

Wiki User

10y ago

What else can I help you with?

Continue Learning about Natural Sciences

What would be the strand of complementary dan produced by the strand of DNA shown below cgt at a?

The complementary DNA strand produced from the given strand "cgt" would follow the base pairing rules of adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, for the sequence "cgt," the complementary strand would be "gca."


Is this strand of DNA was used what would be the complementary DNA produced?

To determine the complementary DNA strand produced from a given DNA strand, you pair the nucleotides according to base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. Thus, the complementary DNA sequence is synthesized in the opposite direction.


What would be the strand of complementary DNA produced by the strand of DNA shown below TCG AAGAsk us anything?

The complementary DNA strand produced from the given DNA strand TCG AAG would be AGC TTC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base on the original strand is matched with its complementary base to form the new strand.


Ask us would be the strand of complementary DNA produced by the strand of DNA shown below CGT ATA?

The complementary DNA strand produced from the given DNA sequence "CGT ATA" would be "GCA TAT." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base in the new strand.


What complentary strand of DNA would be produced from the straind of DNA shown below?

To provide the complementary strand of DNA, I would need to see the specific sequence of the given DNA strand. DNA strands are complementary based on base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the sequence, I can generate the corresponding complementary strand for you.

Related Questions

What would be the strand of complementary dan produced by the strand of DNA shown below cgt at a?

The complementary DNA strand produced from the given strand "cgt" would follow the base pairing rules of adenine (A) with thymine (T) and cytosine (C) with guanine (G). Therefore, for the sequence "cgt," the complementary strand would be "gca."


Is this strand of DNA was used what would be the complementary DNA produced?

To determine the complementary DNA strand produced from a given DNA strand, you pair the nucleotides according to base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. Thus, the complementary DNA sequence is synthesized in the opposite direction.


How do you calculate the tmfvalue?

The melting temperature TM, characterises the stability of the DNA hybrid formed between an oligonucleotide and its complementary strand. At TM 50% a given oligonucleotide can hybridised to its complementary strand. By: Zoya Mobeen


What would be the strand of complementary DNA produced by the strand of DNA shown below TCG AAGAsk us anything?

The complementary DNA strand produced from the given DNA strand TCG AAG would be AGC TTC. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base on the original strand is matched with its complementary base to form the new strand.


Ask us would be the strand of complementary DNA produced by the strand of DNA shown below CGT ATA?

The complementary DNA strand produced from the given DNA sequence "CGT ATA" would be "GCA TAT." In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is replaced by its complementary base in the new strand.


What complentary strand of DNA would be produced from the straind of DNA shown below?

To provide the complementary strand of DNA, I would need to see the specific sequence of the given DNA strand. DNA strands are complementary based on base pairing rules: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). If you provide the sequence, I can generate the corresponding complementary strand for you.


What would be the complimentary bases for a.t.c.g.c.a.t.t. for a dna strand?

A binds with T, G binds with C.Therefore the complementary strand for ATCGCATT would be TAGCGTAA.


What is the base sequence on the other strand?

To determine the base sequence on the complementary DNA strand, you need to know the base sequence of one strand. DNA is composed of four bases: adenine (A), thymine (T), cytosine (C), and guanine (G). The complementary base pairing rules state that A pairs with T and C pairs with G. For example, if the given strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'.


In this strand of DNA was used that would be the complementary DNA Produced?

To determine the complementary DNA strand produced from a given DNA sequence, you need to match each nucleotide with its complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. The directionality of the strands is also important, so ensure to maintain the 5' to 3' orientation when writing the complementary sequence.


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complementary sequence for a DNA sequence is formed by replacing each nucleotide with its complementary base. For the given sequence "atgcccgggtgtcgtagttga," its complementary sequence would be "tacgggccacagcatcaact."


What would be the strand of complementary DNA produce by the strand of DNA tcg aag?

Purine- Adenine, guanine,pyrimidine- thymine, cytosineAdenine pairs with thymineGuanine pairs with cytosineTherefore the complementary strand to TCG AAG is AGC TTC=========================================================A always pairs with T, and C always pairs with G so the complementary strand is as follows:TCG AAG (Original)AGC TTC (Complementary)GCA TAT


What would be the stand of complementary DNA produced by the stand of DNA ATG CGA?

The complementary DNA strand produced from the given DNA sequence ATG CGA would be TAC GCT. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base to form the new strand.