answersLogoWhite

0

What else can I help you with?

Continue Learning about Natural Sciences

If the strand of DNA were used what would be the complementary DNA produced?

To determine the complementary DNA strand, you would pair each base of the original DNA strand with its corresponding complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original strand is ATCG, the complementary strand would be TAGC. This base-pairing rule ensures that the two strands of DNA are complementary, allowing for proper replication and function.


In this strand of DNA was used that would be the complementary DNA Produced?

To determine the complementary DNA strand produced from a given DNA sequence, you need to match each nucleotide with its complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. The directionality of the strands is also important, so ensure to maintain the 5' to 3' orientation when writing the complementary sequence.


F this strand of DNA was used what would be the complementary DNA produced CGA CT?

To find the complementary DNA strand for the given sequence "CGA CT," you need to pair each base with its complementary base: Cytosine (C) pairs with Guanine (G), Guanine (G) pairs with Cytosine (C), and Adenine (A) pairs with Thymine (T). Thus, the complementary DNA produced would be "GCT GA."


If this strand of DNA were used. what would be the complementary DNA produced?

To determine the complementary DNA strand, you would pair each nucleotide with its corresponding base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original strand of DNA is 5'-ATCGTA-3', the complementary strand would be 3'-TAGCAT-5'. This complementary pairing ensures that the two strands are held together by hydrogen bonds, maintaining the double helix structure of DNA.


If this strand of DNA was used what would be the complementary DNA produced tac gg?

AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).

Related Questions

If the strand of DNA were used what would be the complementary DNA produced?

To determine the complementary DNA strand, you would pair each base of the original DNA strand with its corresponding complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original strand is ATCG, the complementary strand would be TAGC. This base-pairing rule ensures that the two strands of DNA are complementary, allowing for proper replication and function.


If this strand of DNA were used GTA CA what would be the complementary DNA produced?

CAT GT. -APEX Learning


In this strand of DNA was used that would be the complementary DNA Produced?

To determine the complementary DNA strand produced from a given DNA sequence, you need to match each nucleotide with its complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original DNA strand is 5'-ATCG-3', the complementary strand would be 3'-TAGC-5'. The directionality of the strands is also important, so ensure to maintain the 5' to 3' orientation when writing the complementary sequence.


What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?

The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.


F this strand of DNA was used what would be the complementary DNA produced CGA CT?

To find the complementary DNA strand for the given sequence "CGA CT," you need to pair each base with its complementary base: Cytosine (C) pairs with Guanine (G), Guanine (G) pairs with Cytosine (C), and Adenine (A) pairs with Thymine (T). Thus, the complementary DNA produced would be "GCT GA."


If this strand of DNA were used. what would be the complementary DNA produced?

To determine the complementary DNA strand, you would pair each nucleotide with its corresponding base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original strand of DNA is 5'-ATCGTA-3', the complementary strand would be 3'-TAGCAT-5'. This complementary pairing ensures that the two strands are held together by hydrogen bonds, maintaining the double helix structure of DNA.


What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?

The template strand is used to make a complementary copy. This is a type of DNA strand.


What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?

During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC


If this strand of DNA was used what would be the complementary DNA produced tac gg?

AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).


If cga ct were used what would be the complimentary DNA produced?

If cga ct were used as a template strand for complementary DNA synthesis, the complementary DNA produced would be gct ga. This is because each nucleotide pairs with its complementary base: cytosine (c) pairs with guanine (g), guanine (g) pairs with cytosine (c), adenine (a) pairs with thymine (t), and thymine (t) pairs with adenine (a). Therefore, the complementary sequence would read from 5' to 3' as gct ga.


What is the complementary strand of DNA?

The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.


If this strand of DNA were used what would be the complementary DNA produced CGA CT?

AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).