0
The complementary DNA strand produced from the given DNA sequence ATG CGA would be TAC GCT. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base to form the new strand.
What else can I help you with?
What strand of DNA would be produced from ATG CGA?
The strand of DNA complementary to the given sequence ATG CGA would be TAC GCT. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Thus, A pairs with T, T with A, C with G, and G with C in the complementary strand.
What DNA strand would be produced with tac gg?
The DNA strand produced from the template sequence "tac gg" would be complementary to it. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, the complementary DNA strand would be "atg cc."
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
What is the complementary strand to AGTCACGGTATCTA?
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
What is the transfer complement for the following DNA sequence ATG?
The transfer complement for the DNA sequence ATG is TAC. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary bases for A, T, and G in the sequence ATG are T, A, and C, respectively, resulting in TAC.
What strand of DNA would be produced from ATG CGA?
The strand of DNA complementary to the given sequence ATG CGA would be TAC GCT. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Thus, A pairs with T, T with A, C with G, and G with C in the complementary strand.
What DNA strand would be produced with tac gg?
The DNA strand produced from the template sequence "tac gg" would be complementary to it. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, the complementary DNA strand would be "atg cc."
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
What is the complementary strand to AGTCACGGTATCTA?
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
What is the complementary stand to this dna molecule g a t c c a t g a g t t a c?
The complementary strand to the given DNA sequence would be C T A G G T A C T C A A T G. This is because in DNA, adenine pairs with thymine and guanine pairs with cytosine.
What is the transfer complement for the following DNA sequence ATG?
The transfer complement for the DNA sequence ATG is TAC. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary bases for A, T, and G in the sequence ATG are T, A, and C, respectively, resulting in TAC.
If this strand of DNA was used what would be the complementary DNA produced tac gg?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What strand of mRNA would be produced from the strand of DNA shown below?
The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.
When was ATG Stores created?
ATG Stores was created in 1999.
What would be the mRNA strand for atg cat tag ttg?
caacuaaugcat
