0
What else can I help you with?
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
What is the complementary strand to AGTCACGGTATCTA?
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
What is the transfer complement for the following DNA sequence ATG?
The transfer complement for the DNA sequence ATG is TAC. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary bases for A, T, and G in the sequence ATG are T, A, and C, respectively, resulting in TAC.
If this strand of DNA was used what would be the complementary DNA produced tac gg?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
What would be the mRNA strand for atg cat tag ttg?
caacuaaugcat
What is the complementary DNA for TAC GG?
The complementary strand of this DNA sequence is... A T G C T A A C C
What is the complementary DNA of atgcatgta-3'?
The complementary DNA strand of ATG-CAT-GTA-3' is TAC-GTA-CAT-5'.
What is the complementary strand to AGTCACGGTATCTA?
give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
What is the complementary stand to this dna molecule g a t c c a t g a g t t a c?
The complementary strand to the given DNA sequence would be C T A G G T A C T C A A T G. This is because in DNA, adenine pairs with thymine and guanine pairs with cytosine.
What is the transfer complement for the following DNA sequence ATG?
The transfer complement for the DNA sequence ATG is TAC. In DNA, adenine (A) pairs with thymine (T), and guanine (G) pairs with cytosine (C). Therefore, the complementary bases for A, T, and G in the sequence ATG are T, A, and C, respectively, resulting in TAC.
If this strand of DNA was used what would be the complementary DNA produced tac gg?
AGTCG (I'm assuming your strand was written in the normal 5' to 3' order, and I wrote mine in that order as well, which means the last residue in my strand pairs with the first residue in your strand, and vice versa).
When was ATG Stores created?
ATG Stores was created in 1999.
What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg?
During transcription, the DNA template is used to create a complementary strand of mRNA (messenger RNA). An A on the DNA template is complementary to a U on the mRNA, T to A and C to G. Therefore the complementary mRNA of TAC-GCG-CAT-TGT-CGT-CTA-GGT-TTC-GAT-ATA-TTA-GCT-ACG is: UTG-CGC-GUA-ACA-GCA-GAU-CCA-AAG-CUA-UAU-AAU-CGA-UGC
What strand of mRNA would be produced from the strand of DNA shown below?
The DNA strand CAT-TAG would produce a complementary mRNA strand of GUA-AUC.
What would be the mRNA strand for atg cat tag ttg?
caacuaaugcat
The nucleotide base sequence of a strand of DNA is TAC-CGG-AGT. What is the sequence of the complementary DNA strand?
The complementary DNA strand to TAC-CGG-AGT is ATG-GCC-TCA. In DNA, adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G), so the complementary strand is created by matching these base pairs.
What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?
The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA
