give the complementary DNA sequence of 5' atg ctt gca cca gtg tga aaa agg gcg?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.
The complementary strand for the DNA sequence ccgatacgcggtatcccagggctaattuaa is ggctatgcgccatatgggtaatgtaagg. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each nucleotide in the original strand is matched with its complementary base to form the new strand.
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
The template strand is used to make a complementary copy. This is a type of DNA strand.
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
The complementary strand of the DNA is TAA-GCT-ACG
The complementary sequence to GAATGC is CTTACG. In DNA, adenine pairs with thymine, so if one strand has a guanine (G), the complementary strand will have a cytosine (C); and if one strand has an adenine (A), the complementary strand will have a thymine (T).
mRNA is complementary to the template strand of DNA during transcription. The template strand serves as a template for mRNA synthesis, directing the formation of a complementary mRNA transcript.
The complementary strand for cttaggcttacca would be gaatccgaatggt. This is formed by pairing adenine with thymine and cytosine with guanine on the opposite strand.
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
The complementary strand of DNA for the sequence AATAGTACGCGAGTCGTGATGAAATTCT is TTATCATGCGCTCAGCACTACTTAAAGA. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each base in the original strand is matched with its complementary base in the new strand.
The complementary base sequence of a DNA strand is formed by pairing adenine (A) with thymine (T) and cytosine (C) with guanine (G). For the template strand TTGCACG, the complementary sequence would be AACGTGC.
The complementary strand for the DNA sequence ccgatacgcggtatcccagggctaattuaa is ggctatgcgccatatgggtaatgtaagg. In DNA, adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). Therefore, each nucleotide in the original strand is matched with its complementary base to form the new strand.
taaggc