0
What else can I help you with?
During DNA replications a complementary strand of DNA is made for each original DNA strand thus if a portion of the original strand is CCTAGCT then the new strand will be?
GGATCGA. Each base in the original DNA strand pairs with its complementary base (A with T and C with G) in the new strand during DNA replication.
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is the complementary DNA strands?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
What is the complementary strand of DNA?
The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.
What is the complementary DNA strand for atgtatcggatccatgtataa?
TACATAGCCTAGGTACATATT
What is the strand of CCTAGCT?
The complement strand of CCTAGCT would be GGATCGA.
During DNA replications a complementary strand of DNA is made for each original DNA strand thus if a portion of the original strand is CCTAGCT then the new strand will be?
GGATCGA. Each base in the original DNA strand pairs with its complementary base (A with T and C with G) in the new strand during DNA replication.
What would the complementary strand of DNA be for the sequence cttaggcttacca?
The complementary strand for the given DNA sequence cttaggcttacca is gaatccgaatggt. This is obtained by pairing cytosine with guanine, thymine with adenine, adenine with thymine, and guanine with cytosine.
Given the following strand of dna what is the complementary strand actggctac?
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
What is complementary DNA strand for att-cga-tgc?
The complementary strand of the DNA is TAA-GCT-ACG
What strand of DNA is use to make a complementary copy or to make a complementary mRNA molecule?
The template strand is used to make a complementary copy. This is a type of DNA strand.
What is the complementary DNA?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
What strand of DNA is used to make a complementary copy or to make a complementary mRNA molecule-?
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
Which enzyme is responsible for adding complementary DNA bases to an exposed DNA strand?
The enzyme responsible for adding complementary DNA bases to an exposed DNA strand is DNA polymerase.
What complementary strand of DNA would be produced from the DNA strand cgt ta?
The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.
What is the complementary DNA strands?
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
When a strand of DNA is ATCG what would the complementary pairings be for the replicated strand of DNA?
TAGC.
