answersLogoWhite

0


Best Answer

GGATCGA is comlementary to the DNA strand CCTAGCT.

User Avatar

Wiki User

13y ago
This answer is:
User Avatar
More answers
User Avatar

Wiki User

10y ago

In DNA, A pairs with T and G pairs with C.

Therefore the complementary strand for the sequence CTT-AGG-CTT-ACC-A is GAA-TCC-GAA-TGG-T.

This answer is:
User Avatar

User Avatar

Wiki User

14y ago

5' ACTCTG 3' = 3' TGAGAC 5'

This answer is:
User Avatar

User Avatar

Wiki User

13y ago

accgtggc

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: What would the complementary strand of DNA be for the sequence cttaggcttacca?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

What would the complementary strand of DNA be for the sequence of the base Cttaggcttacca?

lol i hate this question........its in meh science book


What is the complimentary strand for DNA for the sequence base of cttaggcttacca?

lol i hate this question........its in meh science book


What would be the base sequence of the complementary mRNA strand?

TGCA


What is the complementary sequence for atgcccgggtgtcgtagttga?

The complimentary DNA sequence would be TAGGCGATTGCATTGGG. The complimentary mRNA sequence would be UAGGCGAUUGCAUUGGG.


A segment of DNA has the following sequence TTAAGGCC. Which sequence of bases would be found on the complementary strand of mRNA?

The complimentary strand of MRNA would be AAUUCCGG.


What is the sequence of the complementary DNA strand gaattcggca?

Simple you just look at what base it is then what ever base would be complementary to it, is your answer. ATTGTCCAGT is your answer


Complementary strand of dna AAT?

Answer and Explanation: For the sequence 5′-GATTACA-3′, the complementary DNA strand would be 3′-CTAATGT-5′. Often, DNA strands are written in the 5′ to 3′ direction, so the complementary strand would be 5′-TGTAATC-3′ when written 5′ to 3′. What is complementary to mRNA?


If a sequence on one DNA strand reads A-T-C-C-T-G-C-A what will the complementary strand sequence read?

It would be T-A-A-G-C-C


A segment of DNA has the following sequence ttaaggcc which sequence of bases would be found on the complementary strand of mrna?

TGCA


What is the complementary strand of DNA?

Yes, strands of DNA are complementary. Complementary implies that a sequence of nucleotides (ex. ATATG) is ordered in a way that it directly corresponds to another sequence of nucleotides (ex. TATAC). Since DNA is double stranded in most circumstances, barring mutagenesis, one strand would be pair with its complementary strand, thus forming the double stand.


What is the nucleotide sequence of the complementary strand of the dna molecule t t c g a a t t g c?

The sequence of nucleotides of the complementary strand will be the nucleotides which bind to the nucleotides of the template. In DNA, adenine binds to thymine and cytosine binds to guanine. The complementary strand will therefore have an adenine where the template strand has a thymine, a guanine where the template has a cytosine, etc. For example: If the template strand is ATG-GGC-CTA-GCT Then the complementary strand would be TAC-CCG-GAT-CGA


What is the complementary base sequence of cagttagc-oh?

A binds with T, C binds with G. Therefore the complementary DNA sequence will be GTCAATCG. The complementary RNA would be CAGTTAGC. The OH means it is the 3' end - so the complementary strand would be 5' at the same spot.