TACATAGCCTAGGTACATATT
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
GGATCGA is comlementary to the DNA strand CCTAGCT.
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.
To determine the complementary DNA strand, you would pair each base of the original DNA strand with its corresponding complementary base: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). For example, if the original strand is ATCG, the complementary strand would be TAGC. This base-pairing rule ensures that the two strands of DNA are complementary, allowing for proper replication and function.
The complementary DNA strand to ACTGGCTAC is TGACCGATG.
The complementary strand of the DNA is TAA-GCT-ACG
The template strand is used to make a complementary copy. This is a type of DNA strand.
GGATCGA is comlementary to the DNA strand CCTAGCT.
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
The template strand of DNA is used to make a complementary copy during DNA replication, while the antisense (non-coding) strand is used as a template for complementary mRNA synthesis during transcription.
The enzyme responsible for adding complementary DNA bases to an exposed DNA strand is DNA polymerase.
The complementary strand of DNA to cgtta would be gcaat. This is because in DNA, cytosine pairs with guanine and thymine pairs with adenine.
A complementary strand of DNA contains the template information for the creation of a new copy of the other strand. How is it determined?
TAGC.
This Process Is Called DNA Transcription. *Apex*
The complementary strand of DNA is a strand that matches the sequence of the original DNA strand through base pairing rules. Adenine pairs with thymine (A-T) and cytosine pairs with guanine (C-G). This results in two DNA strands with complementary sequences that can be used for replication and transcription.