What are the four genetic disorders?

Answer 1

-Insertions

-Deletions

-Replacements

-Flips

•AAATTGCTACGTCGATCGATCGGCCT

•AAATTGCTACGTCGATGATCGGCCT

•AAATTGCTAGCGTCGATCGATCGGCCT

•AAATTGCTACGTCGATCGCTCGGCCT

•AATATGCTACGTCGATCGATCGGCCT

Answer 2

The 4 types of genetic variation are

1) mutation- is the mutation of a gene. this is really rare, most mutations are in the recessive trait so they are hidden by a dominant trait. Most mutations have no effect but some can be harmful and very few have positive effects. There is a lot more on mutation so i suggest you look it up.

2) Genetic recombination- is the formation of new conbinations of alleles during sexual reproduction. This happens alot during crossing over. Every one is different because you get a mix of genes from your mom and dad.

3) migration- is when an individual who moves into a population brings different genes that may not be present in the population, it has the most effect on a small population.

4) Genetic drift- when a few individuals have a trait that the rest of the population doesn't have and if these organisms die off without mating, then they die in the gene pool. this reduces variation in a population so it makes less evolution

Answer 3

Forms, Population, Measurement, Mutation are the four terms with genetic variation. Maintenance in population is also another key aspect of the variation.

Answer 4

Red-Green Colorblindness, Hemophilia, Klinefelter's syndrome, Down's Syndrome.

Answer 5

reptile, mammal, amphibian, bird