answersLogoWhite

0

What are the meez codes for December 2010?

User Avatar

Anonymous

∙ 14y ago
Updated: 8/19/2019

CandyCaneBoots expires decmeber 7th 2010!!

User Avatar

Wiki User

∙ 14y ago
Copy

What else can I help you with?

Related Questions

Meez codes December?

Meez Code For December 2010 and you will get 250 coinz : technohoodies


What is the new meez codes for December 2010?

new code for meez: happynewyears


What are some recent meez codes in December close to 2010?

CandyCaneBoots it expires 7th of December 2010


What are some meez codes that are new?

For December 2010,there is one that is.. (this will expire December 20,2010 (: 20PERCENTMORECOINZ


What are meez codes for sept 18th 2010?

look at the question : "what are meez codes for 2010"


Meez codes for December?

No we are still checking!


Meez codes for December 2009?

HIPHOP2009


What are the meez codes for January 2010?

BICH09


Meez codes for January 2010?

its joemammaeatsmykookies


What is February meez codes for 2010?

bemyvalentine


What are meez codes for decmber 2010?

money56790


What are meez codes for October 2010?

vampirebat2010

Trending Questions
What are the organs located in hypogastric region? Which A-level subjects do I need to take if I am are persuing a degree in mass communication? What country invaded Korea in 1592? What is 21 degrees and 21 mins north and 157 degrees and 57 mins west? A White Computer Desk Can Be Calming? What gang has a burgundy flag? How do you say thank you so much in chuukese? How do you round 58.635 to the nearest hundredth? Can lifting weights cause constipation? What are the differences between responses of mammals and flowering plants? What is the area of the excel window in which you enter and edit data? Did descartes believe in the very powerful evil demon? Where do you get a diamond armlet? How far is it from Greenville SC to Cocoa Beach FL? What is an graphical operating system? What is a fem agress? Can a self cleaning oven be stopped before it's done? What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA? What did Joe Frazier do? What rhymes with calories?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.