0
Complementary colours are pairs of pure spectral colours that, if mixed in the right intensities, will produce the same visual sensation to the human eye as white (or nearly white) light. Complementary colour pairs include certain yellows and blues, greens and blues, reds and greens, and greens and violets.
Wiki User
∙ 15y ago
Add your answer:
Earn +20 pts
Complementary strand of DNA for gene segment gccaatgct?
The complementary DNA strand is CGTTTGATGG. A pairs with T, and G pairs with C.
The complementary base pairs in a DNA molecule are stabilized by?
hydrogen bonds
In DNA complementary base pairing occurs between what?
Adenine pairs with Thymine ( A-T) Guanine pairs with cytosine ( G-C)
Due to the strict pairing of nitrogen base pairs in DNA molecules the two strands are said to be what to each other?
complmentary
What would be the strand of complementary DNA produce by the strand of DNA tcg aag?
Purine- Adenine, guanine,pyrimidine- thymine, cytosineAdenine pairs with thymineGuanine pairs with cytosineTherefore the complementary strand to TCG AAG is AGC TTC=========================================================A always pairs with T, and C always pairs with G so the complementary strand is as follows:TCG AAG (Original)AGC TTC (Complementary)GCA TAT
What is complementary to CGT AT?
In DNA, C pairs with G, and A pairs with T.This means that GCATA is complementary to CGTAT.
Complementary strand of DNA for gene segment gccaatgct?
The complementary DNA strand is CGTTTGATGG. A pairs with T, and G pairs with C.
The complementary base pairs in a DNA molecule are stabilized by?
hydrogen bonds
What are complementary base-pairs?
Adrenine (A) pairs with Thymine (T) Cytosine (C) pairs with Guanine (G)
What are the DNA complementary bases pairs?
In DNA, cytosine (C) pairs with guanine (G) and thymine (T) pairs with adenine (A).
Quadrilateral ABCD is a parallelogram in which angle A equals 40 degrees Which two angles below are complementary?
A and B, B and C, C and D, D and A, are all supplementary pairs. The figure has no complementary pairs of angles.
Do intersecting lines form four pairs of complementary angles?
No, intersecting lines form four pairs of supplementary angles
What pairs up with each half of the DNA molecule?
Adenine pairs with Thymine, Cytosine pairs with Guanine
Can three angles be complementary?
No only two angles can be complementary
In DNA complementary base pairing occurs between what?
Adenine pairs with Thymine ( A-T) Guanine pairs with cytosine ( G-C)
Explain the difference between the following pairs of complementary angles and supplementary angles?
Complementary angles sum to 90o Supplementary angles sum to 180o
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). I remember this because A paired with T spells AT. The complementary DNA sequence to TGCCAT is ACGGTA.
