answersLogoWhite

0

Complementary colours are pairs of pure spectral colours that, if mixed in the right intensities, will produce the same visual sensation to the human eye as white (or nearly white) light. Complementary colour pairs include certain yellows and blues, greens and blues, reds and greens, and greens and violets.

User Avatar

Wiki User

18y ago

What else can I help you with?

Related Questions

What is complementary to CGT AT?

In DNA, C pairs with G, and A pairs with T.This means that GCATA is complementary to CGTAT.


Figure 8.2 shows a single strand of DNA. choose the first three nucleotides of the complementary rna strand.?

To determine the first three nucleotides of the complementary RNA strand, you need to match the DNA bases with their RNA counterparts. In DNA, adenine (A) pairs with uracil (U) in RNA, thymine (T) pairs with adenine (A), cytosine (C) pairs with guanine (G), and guanine (G) pairs with cytosine (C). If the first three nucleotides of the DNA strand are, for example, A, T, and C, the complementary RNA strand would have U, A, and G as its first three nucleotides.


What sequence is complementary to aggtac?

The complementary sequence to aggtac would be tccatg. T is complementary to A and C is complementary to G.


What are complementary base pairs and can you provide an example?

Complementary base pairs are nucleotide bases in DNA that always bond together in a specific way: adenine (A) pairs with thymine (T), and cytosine (C) pairs with guanine (G). An example of complementary base pairs is A-T and C-G.


What are the complementary base pairs in DNA?

The complementary base pairs in DNA are adenine (A) with thymine (T), and cytosine (C) with guanine (G).


According to the rules of complementary base pairing a nucleotide containing the base cytosine would pair with a nucleotide containing the base of?

The base cytosine pairs with guanine via three hydrogen bonds. They are complementary base pairs in the DNA double helix.


What are the 6 color schemes?

The six color schemes are monochromatic, analogous, complementary, split-complementary, triadic, and tetradic (or double-complementary). Monochromatic uses variations of a single hue, while analogous combines colors that are next to each other on the color wheel. Complementary pairs opposite colors for high contrast, and split-complementary involves one base color and the two adjacent to its complementary. Triadic utilizes three evenly spaced colors, and tetradic incorporates two complementary color pairs for a vibrant palette.


Complementary strand of DNA for gene segment gccaatgct?

The complementary DNA strand is CGTTTGATGG. A pairs with T, and G pairs with C.


What are the correct complementary base pairs in DNA?

The correct complementary base pairs in DNA are adenine (A) with thymine (T), and cytosine (C) with guanine (G).


What are complementary base-pairs?

Adrenine (A) pairs with Thymine (T) Cytosine (C) pairs with Guanine (G)


In a DNA molecule what base sequence is complementary to the sequence CGAC?

The base sequence complementary to CGAC in a DNA molecule is GCTG. In DNA, cytosine (C) pairs with guanine (G), and adenine (A) pairs with thymine (T), so you would replace each base with its complementary counterpart. Therefore, C pairs with G, G pairs with C, A pairs with T, and C pairs with G.


What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?

The complementary DNA sequence to CGGCCTTCAATAGGTCCCAAA is GCCGGAAGTTATCCAGGGTTT. In DNA, adenine pairs with thymine and guanine pairs with cytosine, so in the complementary sequence, each base is replaced by its complement.