answersLogoWhite

0

What binds with uracil in RNA?

Updated: 8/10/2023
User Avatar

Wiki User

14y ago

Best Answer

Regarding genetic material:

Uracil is found in RNA, it base pairs with adenine and is replaced by thymine in DNA. Methylation of uracil produces thymine. It turns into thymine to protect the DNA and to improve the efficiency of DNA replication. Uracil can base pair with any of the bases depending on how the molecule arranges itself on the helix, but readily pairs with adenine because the methyl group is repelled into a fixed position. Uracil pairs with adenine through hydrogen bonding. Uracil is the hydrogen bond acceptor and can form two hydrogen bonds. Uracil can also bind with a ribose ring to form a ribonucleoside, uridine. When a phosphate attaches to uridine, uridine 5'-monophosphate is produced.

User Avatar

Wiki User

15y ago
This answer is:
User Avatar
More answers
User Avatar

Wiki User

14y ago

Adenine

This answer is:
User Avatar

Add your answer:

Earn +20 pts
Q: What binds with uracil in RNA?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

3 DNA does NOT contain the nitrogen base?

DNA does not contain uracil. RNA does!! DNA contains guanine binds with Thymine in DNA RNA contains guanine that binds with uracil DNA does not contain uracil. RNA does!! DNA contains guanine binds with Thymine in DNA RNA contains guanine that binds with uracil


What is the nitrogen base that pairs with adenine in RNA?

In RNA, adenine binds to Uracil. In DNA it binds to thymine.


What is the mRNA strand for CTTCCGGATCGAGGAAAGGCCAGA?

GAAGGCCUAGCUCCUUUCCGGUCA G binds to C and A binds to U. Remember that in RNA, uracil replaces thymine.


What are the nitrogen bases in RNA and what binds to what?

they are adenine, guanine, cytosine and uracil (in place of thiamine) adenine binds with uracil and vice versa (with two hydrogen bonds) guanine bind with cytosine and vice versa (with three hydrogen bonds)


What is a nitrogen base that is found only in RNA but not DNA?

The nitrogen containing base that is found only in RNA is uracil. It takes the place of thymine in DNA


In DNA what does adenine always pair up with?

In DNA replication, adenine binds with thymine. In RNA, adenine binds with uracil.


What nucleotide does Adenine bind?

In DNA adenine binds to thymine. In RNA adenine binds to uracil. Adenine can also bind the modified nucleotide base inosine.


What is the base of RNA in place of thymine which bonds with adenine?

The nitrogen base uracil takes the place of thymine in RNA. So in RNA, uracil pairs with adenine.


What is in RNA but not in DNA?

Uracil is present in RNA but not in DNA. DNA contains thymine instead of uracil.


What is in RNA but not in RNA?

RNA is single stranded and has Uracil instead of Thymine.DNA is double stranded and has Thymine, not Uracil.


Does RNA contain the nitrogen base uracil?

NO. RNA contains URACIL while in DNA it is THYMINE, the uracil replaces the thymine.


Base in RNA and not in DNA?

Uracil. Uracil replaces thymine in RNA.