0
What else can I help you with?
Related Questions
What does a German shephard eat?
German Shephard eats meat.
What is the plural of German shephard?
German shephards.
Can a German Shepherd survive bladder cancer?
how long can german shephard live with bladder cancer with no treatments like chemotherapie or surgery
Can you ship a German shephard?
not by aircraft
How do you spell German Shephard?
It should be spelt as German Shepherd.
How fast is a German shephard?
the German shephard is a very, very fast dog its legs are very strong. That leg power is used in the army
Were does German shephards live?
German Shephard dogs are domesticated animals living in homes. German Shephards are fine in small areas as long as they have a great amount of time to exercise. :)
Can adoberman kill German shephard?
yes
Where does Quinn shephard live?
Quinn Shephard live in somewhere in New Jersey or New York.
What breed of dog come from Germany?
German Shephard
How big can a German shephard grow?
Up to 60cm
What is the German shephard range?
All over the world.
Trending Questions
What is the full form for SHEM?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
How does jem try to make scout feel beter after he conversation with aunt alex andra?
How much does an ounce of lawrencium cost?
What is ducktape for?
Who is martinique president?
What red gemstones can one have set in a ring?
What muscles are used doing the splits starting from standing?
What is the land area from which a stream gets water?
What is it like at Mecca?
Why does Douglass believe that people should be allowed to move freely from one country to another?
How do you use boilerplates?
What does the idiom 'In black and white' mean?
How do you put aerobe in a sentence?
What is the cost for a valve job on a 1999 GMC suburban?
Why do AC lines freeze up and how can this issue be prevented?
How many credits will FAFSA pay for?
Is France a European country?
What is the Japanese word for rabbit?
In badmintion what is a powerful downward stroke?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.