0

What changes occurred during the Renaissassnce?

Anonymous

∙ 13y ago

Updated: 8/20/2019

people began to get their knowledge back and many artists tried to learn everything they could about everyting.

Wiki User

∙ 13y ago

What else can I help you with?

Related Questions

What climate changes occurred during the stone ages?

Yes What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?

What climate changes during the stone ages?

Yes What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?What Climate changes occurred during the Stone Ages?

What were changes that occurred during the Industrial Revolution?

xa

What changes occurred for blacks during the 1920s?

Positive changes resulted from the Harlem Renaissance.

Which of these changes occurred during the Renaissance?

The Church's power declined.

What were three changes that occurred during the Industrial Revolution?

xa

What were 3 changes that occurred during the industrial revolution?

I survived

What changes occurred during Reconstruction?

S**T happened

What are some of the changes that occurred in music during the 1960s?

it hasn't

What positive changes occurred during reconstruction?

S**T happened

What economic changes occurred during the Reconstruction Era of the United States?

Potatoes.

What changes occurred during the tang dynasty?

They made everyone worship cows .

Trending Questions

How do you get relichant in Pokemon? British most wanted? How many grams is 4 cups of diced apples? What are the differences between water erosion and water deposition? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? How does the process of newborn skull development impact overall growth and development in infants? What causes a transaxle on my 2005 Ford Freestar to get hot? Who kills Alison in Pretty Little Liars? Are there any data free usage apps on iPhone? Different Types Of Arousal in sport? Where do toadfish live? How can you call the people on a congregation? How long does it take for a tree to fully be grown? When does Suburgatory season 2 come out on DVD? What is the mission statement for abbott labs? What was the delorian car made of? How much does a steinway d cost? How do you troubleshoot a moving fuel gauge on a 2000 Chevrolet impala 3.4L? How do you tell how old a terrapin is? What is 4198 to the nearest 100?

Resources

Top Categories

Product

Company

Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.