0
What else can I help you with?
Related Questions
Is Philadelphia a city or a state?
It is both a city and a county within the US State of Pennsylvania.
Oklahoma City is the capital of what US state?
Oklahoma City is the capital of the US State of Oklahoma.
Which city in the US is not a state?
There are no cities in the US that are a state. There is one city that isn't IN any state, and that is Washington D.C.
Is the US a city state?
NO
What is the only city in United State that is not a state?
The only city in the US that is not in a state is Washington, D.C.
Where is the driest city in the US is in the state of?
Yuma, Arizona is the driest city in the US.
Is Miami a state in the US?
No, Miami is a City within the US State of Florida.
What is the only city in us that is not a state?
uhh, no city is a state. this question makes no sense.
What the only city in the US that is not in a state?
uhh, no city is a state. this question makes no sense.
Is Vermont a state or city?
Vermont is a state in the US.
Which is not a state in the US?
There are no cities in the US that are a state. There is one city that isn't IN any state, and that is Washington D.C.
Is US A city or a state?
country
Trending Questions
Choose the connective that belongs in the blank in the following sentence you like to play baseball you cannot throw a ball very well a however b in fact c. for instance c. besides?
Is epoxy dishwasher safe?
Is Caroline costa and Abraham mateo dating?
Werere can you get pictures of sakura kinomoto tied up in rope tape gagged and beer feet and skaura chair tied gagged and get her toes and feet tickled and sakura traped in a net and skaura warpped up?
How many children did Queen Elizabeth mum have?
Is colombia the largest spanish speaking country in south america?
What examples of ethnocentrism are there in healthcare?
Is the square root of 22 irrational or rational?
Can you leave a spoon in food in the refrigerator over night and still eat it?
How much oil is in a 2002 Kia Rio?
Is colony farm pond frozen in the winter?
Who was a one legged sailor with a parrot?
What is the ampere of split type air con?
How many times does 13 go into 74?
When the product of 10 and 15 is divided by the sum of 10 and 15 what is the quotient?
Is the virtue of courage enable one to face danger?
How many percent you pay for federal taxes and state taxes on IRA rmd?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
What is a picture that exaggerates a person's features?
What is the use of a sewing machine?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.