0
What else can I help you with?
Related Questions
What countrie is Mount Everest in?
Antartica
Where is Mount Everest located in California?
Mount Everest is located in Asia, not California.
What is range of Mount Everest?
Mount Everest is in the Himalayan mountain range.
What ocean is mount Everest located in?
Mount. Everest is located in Nepal, not an ocean.
Where is mount Everest located in aisa?
Mount Everest is located on the border of Tibet and Nepal.
What contenint is mount Everest located and what country?
Mount Everest is located on the border of Nepal and Tibet
What plain is Mount Everest located near?
Mount Everest is located in the Himalayan Mountains range.
Where is Mount Everest located in the us?
Mount Everest is located on the border of Tibet and Nepal, it is not in the USA
What country is Mount Everset in?
Mount Everest is in Nepal
Is Mount Everest Located in a city?
Mount Everest the highest mountain on earth is not located in a city. You will find Mount Everest on the border of Tibet and Nepal in the Himalayan Mountains.
Where is Mount Everest loquaded?
Mount Everest is located on the border of Tibet and Nepal
Where is Mount Everest locating?
Mount Everest is located on the border of Tibet and Nepal.
Trending Questions
What is the difference between a white wizard and a grey wizard?
What is a cantus?
How long should there be light for a fresh water tank?
Who is jimmy studebaker?
On a balance sheet what does members' deficit mean?
What is a fabrica dearmas oviedo 1931 worth?
What does cephalic means in ultrasound?
Words that start with the letter g and end with the letter R?
What is the song from the Glee commercial lyrics are I'm ready now or something like that?
When was greek salad invented?
Why would you expect a dead zone to start near the mouth of a river where the river flows into a body of water?
What are euro notes made of?
What is the definition of the word geo?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
You just burned your finger on a pan that just came out of a 400 degree oven what should you do?
What was the name of Joey's soap opera?
What nationality is the surname Goike?
What is the connotation of the word prim?
Kasukdulan parte ng sa pula sa puti ni francisco rodrigo?
Who wrote the poem street music?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.