0
What else can I help you with?
Related Questions
What year did adolf hilter get married?
In 1945.
Who is responsible for Death of million Jew's?
Adolf Hilter
What was Adolf Hilter's regime called?
The Third Reich
What was Adolf hilter's moustashe called?
Chaplain's pubes brush
How did Adolf Hilter gain popularity?
expoliting people's concerns
When does Adolf Hilter become chancellor?
On 30 January 1933
What was adolf hilter's fascist manifesto called?
Mein Kampf (My Struggle)
Where is adolf hilter from?
Adolf Hitler was born in Braunau am Inn in Austria. He was a German politician and the leader of the Nazi party.
What state was Adolf hilter born in?
Adolf Hitler was born in Braunau am Inn, Austria
Who was with adolf hilter when he died?
His wife of only a couple of hours, Eva Braun.
Did Adolf hilter have a grand daughter?
No, Hitler never had any children or grandchildren.
What was Hitler educational background?
He dropped out of school at age 16.
Trending Questions
Does Zipporah And Moses Ever Have A Child?
How does the size of the moon compare to the size of the Earth?
What is a gas furnace and its advantage?
Where is the thermostat located on a 1992 Cadillac Seville?
Is this a tear and tears homophone or homograph?
What year was Henry viii became king of England?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
What county is shannon airport in?
Where are plastic bottles assembled?
How many years does a felony show up on a background check in AZ?
Are rhinoes cold blooded or warm blooded?
What was the name of the 282 laws that were established by king Hammurabi?
What do the markings on the side of a B-52 mean?
How can you locate your towed car?
When did Alexander MacDonald Shook die?
Why did the colonial times need surveyors?
Does beef jerky have worms?
Is a wolf spider bite dangerous and what are the potential risks associated with it?
Is dbz infinite world on xbox 360?
Are plastic bags toxic?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.