0
What else can I help you with?
Related Questions
What day was June 1 1942?
Monday.
What day of the week was Dec 1 1942?
It was a Tuesday.
What day of the week was 1 March 1942?
it was a Sunday.
What day of the week was December 1 1942?
December 1st, 1942 fell on a Tuesday.
What day of the week was June 1 1951?
1 June 1951 was a Friday.
What day of the week was June 1 1975?
June 1 1975 was on a Sunday.
What day of the week will be June 1 2010?
June 1 2010 will be on a Tuesday.
What day of the week was June 1 2005?
June 1 2005 was a Wednesday.
What day of week was June 1 1953?
June 1, 1953 was on a Monday.
What day of the week was June 1 2001?
June 1 2001 was a Friday.
Which day of the week was 1991 June 1?
1991 June 1 was a Saturday.
What day of the week was June 1 2010?
June 1 2010 was a Tuesday.
Trending Questions
What are the largest townships in Pennsylvania?
What are the key techniques to master for a successful volleyball underhand serve?
What was President Hoover's role in the Great Depression?
What was the Hopi Indians main food source?
What factor changed Woodrow Wilson's opinion about entering world war?
What must happen in order for pregnancy to occur?
What band was Louis tomlimson in when he was 14?
What do optometrists need to wear to work?
How did Brightheart get that big scratch on her eye?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What is the area of Saskatoon Metropolitan Area?
How far is the Iditarod race?
What are two methods to finding the area of a rectangle?
What is the area of Coray?
Use the graphing calculator to graph and find the zeros of the function y 2x2 plus 0.4x and ndash 19.2. The zeros of the function are?
An ion that has 18e- and a net charge of plus 2?
What is sma 7 lab test?
What does it mean when my dog Twitches like he has the hiccups?
Explain how bacterial cells can function without a nucleus?
How much do you get paid for 23 hours and 15 minutes at 7.25 per hour?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.