0
What else can I help you with?
Related Questions
What day of the week was December 08 1952 on?
December 8, 1952 was a Monday.
What day of the week was 17th December 1952?
December 17, 1952 was a Wednesday.
What day was December 21 1952?
December 21, 1952 fell on a Sunday.
What day of the week was December 19 1952?
December 19 1952 was a Friday.
What day of the week it was December 25 1952?
December 25, 1952 fell on a Thursday.
What day of the week was December 6 1952?
December 6, 1952 fell on a Saturday.
What day of the week is December 18 1952?
December 18, 1952 fell on a Thursday.
What day of the week was December 23 1952?
December 23 1952 fell on a Tuesday.
What day of the week was December 5 1952?
December 5, 1952 fell on a Friday.
What day of the week was December 7th 1952?
December 7th, 1952 fell on a Sunday.
What day of the week was 5th December 1952?
December 5, 1952 fell on a Friday.
What day of the week was December 8th 1952?
December 8th, 1952 fell on a Monday.
Trending Questions
Who was Nixon's opponent in the 1960 election?
Who would win walker the Texas ranger or Rambo?
Do the Muslims have weekly church days?
Are theories usually discovered or developed?
Why do cardboard boxes get squashed by a shovel?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
What are the benefits of using a home stair climber for improving cardiovascular fitness and lower body strength?
Which technical discipline has the following goal- to demonstrate new and emerging technologies that have a direct application to military systems?
Harriet Beecher Stowe had always opposed slavery?
Is it a pipe or not?
What is a good science fair conclusion?
What is the Italian American population?
What is a mountain range that starts with a c?
Where does Elliot yamin live?
Why was sugar ray important?
What conditions are treated by cyclocryotherapy?
What is mean by sensitive devices?
What measures the average energy of random motion of particles of matter?
What kind of subs should you get for BMW 745i?
What does the letters in electromagnetic mean?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.