0
What else can I help you with?
Related Questions
What does math have to do with being a scientist?
Sometimes in Science you will have to measure things and/or you will have to find the average. So basically that's what math has to do with being a scientist.
What is math for a scientist?
I think it is Mathematician
What do you call a British scientist?
A scientist.
What do scientist call the seahorse?
Scientist call the seahorse a "Hippocampus"; a latin word
How do scientist use math in their work?
all of them
How does being a scientist involve math?
Yes many branches of science involve math
What math skill do scientist rely on when they cannot find the exact number?
Scientist often rely the math skill of estimates when they cannot find the exact number.
What do you call a scientist that studies robotics?
A biotechnology scientist.
What do you call a scientist that does military research?
A military scientist
What college majors are best suited for people who are good at math?
Maybe a math teacher, mathematician, or a math (mad) scientist!Get it?
Gas can be measured either by what?
I have no idea. Call a scientist or something I have no idea. Call a scientist or something
What did nicolaus Copernicus contribute to math?
he was a scientist and a math geek but there is really no information on what he did as a mathematical figure
Trending Questions
How do you stop remembering the bad things of the past?
What is 'Have a good afternoon' in French?
What causes sleep apnea?
How do you replace voltage regulator?
What do both plants and animals need to survive?
If the probability of type 1 error is reduced the probability of type 2 error is also reduced?
Why did they use bells on horse harness?
If i put 100 dollars in a prepaid credit card will the card be useless until i put more money in it after i spend all 100 dollars or is that the case for prepaid DEBIT cards?
How do you say I love you my princess in spa nish?
What to do when your ex boyfriend tells you he misses you and still loves you?
Who did the Indian National Army fight in World War 2?
JLS were runners-up in the 2008 X Factor final but who to?
Is hypothalamus responsible for vitiligo?
How do you replace tail light 2006 Pontiac Solstice?
Lyrics to the song burn this disco out by Michael Jackson?
Is it the hose or whole radiator if leaking antifreeze?
A river or steam that flows into a larger stream or other bodies of water?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
How much it will cost for 92.7 Big FM radio station in nellore?
When did Michael Jordan start to play with th Chicago Bulls?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.