answersLogoWhite

0

What does 500 kilometers equal?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

500 kilometers is EXACTLY equal to 500,000 meters.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

What is 500 miles equal?

500 miles is 804.67 kilometers.


How many meters equals 500 kilometers?

500 kilometers is equal to 500,000 meters.


500 metres equal how many kilometers?

1000 metres = 1 kilometres so 500 m = 500/1000 km = 0.5 km. Simple!


What is is 500 miles in kilometers?

500 miles = 804.67 kilometres


500 kilometers is how many meters?

500 kilometers is equal to 500,000 meters because there are 1,000 meters in a kilometer.


How many kilometers equal 500cm?

500 centimeters (cm) = 0.005 kilometers


How many meters equal 0.5 kilometers?

500 meters = 0.5 kilometers


How many kilometers equal 500 meters?

Prefix 'kilo' is used to denote multiplies of meter and uses factor 1000. To convert meters to kilometers, value of meters has to be divided by factor used with prefix 'kilo': 500 meters = 500 / 1000 = 0.5 kilometers


2.5km is equal to how many millimeters?

2,5 kilometers (2 500 meters) is equal to 2 500 000 millimeters.


Is 5 km 500 m?

No, 5 kilometers is not equal to 500 meters. In fact, 5 kilometers is equal to 5,000 meters, as 1 kilometer is equal to 1,000 meters. Therefore, 5 km is ten times longer than 500 m.


500 meters equal how many kilometers?

.5 km


What is 5 kilometers in 500 meters?

5 kilometres is equal to 10 x 500 metres

Trending Questions
Can a parent kick you out if you are over the age of 18? What is the Gosselin family's political affiliation? How tall is Radhaa Nilia? What level does lombre learn fake out? Which of the following is NOT one of the so-called pillars of primary health care as outlined by the Declaration of Alma Ata? What are animal claws used for? What is the distance between two longitudes at the equator? Does ingrown toenail surgery hurt? When was Black dress of Rita Hayworth created? Who does Mr Pilkington represent in Animal Farm? Is the moon made out of sand? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What if caffeine does not have an effect on you? What is the definition of futile? Why is there an Australian midget pooping in your attic? How much does a cintas ssr make? Michael's Coupons? What does miogynistic mean? What are three examples of governmental actions that might interfere with free market? What are the 4 major civic duties?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.