0
What else can I help you with?
Related Questions
What are shinee's fans called?
their fanclub is called "the shinee world" and their fans are known as shawols.
What does shawols stand for shinee fans 'is it acronyms or Korean or something?
a SHAWOL is a SHINee fan :) Shawol is short for `SHINEE WORLD`
Who is the leader for SHINee?
Onew
Who is the leader of SHINee?
onew is :)
Who is the cutest in shinee?
Of course, Onew.
Is onew know as onyu?
yup,onew(shinee) also known as onyu^^
What is SHINee's Onew favourite color?
Onew's favorite colors are yellow and red.
What is Onew shinee favorite colour?
chicken color
Who is short-sighted in SHINee?
i think its Key and Onew
Who is the oldest member at shinee?
Onew is the oldest member
Does SHINee have MySpace?
no.. but the shinee had a me2day acount and all of them shares the same account and onew has his own me2day...
Does Onew in SHINee have earrings?
He doesn't... i know that jonghyun and key does.
Trending Questions
Should juveniles being tried as adults?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
The point where two air masses meet is called a?
How do you get seaman's book what are the requirements?
How did science and technology lead to the growth of Mayan influence?
What is 10 million divide by 9.856?
From where is Vanessa Hudgens mother?
How can you find garibaldi fish?
What is the time to turn a distance of 1 degree?
When was theora stephens born?
Which continent are the himalaya mountains located?
Where do you often find an adjective?
Did Hernando De Soto ever go to school?
Is Hansel and Gretel American literature?
Did Kristinia Debarge go to South Pasadena High School or was she homeschooled?
Is 3 days enough to have a opiate free urine sample?
What do the doctors say about marijuana in your system?
Is regardless a verb?
ranslate this phrase into an algebraic expression.23 more than twice Mai's savingsUse the variable m to represent Mai's savings. how do i do this?
What was The French courtly love song of the Middle Ages called?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.