0
What else can I help you with?
Related Questions
What does the Sl stand for in Sl units of measure?
An expanded metric system called the International System of units.
What does pt stand for in the metric system?
There is no pt in the metric system. In the Imperial system, it stands for pint.
What does km stand for in the metric system?
Kilometres. What does JHC stand for?
What is ml stand for in metric unit system?
It is Millilitre
What does Lm stand for in metric system?
Lick mice
What does sec stand for in the metric system?
It stands for a second.
In the metric system what does S stand for?
S is the symbol for second.
What does mA stand for in the metric abbreviations?
In the metric system, mA stands for milliAmpere, 1/1000 of an Ampere.
What does cg stand for in the metric system?
1 centigramme (cg.) = 0.01 "
What dose SI stand for in science?
International System. (in French in the original.) a.k.a. the metric system.
What does Sl mean in metric system?
- Lenght - Mass - Time - Current - Temperature - Luminous Intensity - Number of Particles
What are SI Units and what does the SI stand for?
si units are based on the metric system system international (French) international system (English)
Trending Questions
Where is the Ferrari car manufactured?
Why are my lifters tapping after flood water was drained from the engine and the oil has been changed?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Did Alexander Fleming do bad?
What is the meaning of game over?
What is 390.98 rounded to the nearest square meter?
What are intercalated disks?
Why do you think graphs are a useful way to display information?
Who is lyasan utyasheva?
What objects in outer space can hit earth and cause major damage to earth?
Why do Tamils wear dhotis?
How much is yu gi oh card number 39 utopia worth?
How much should you feed your 30 lb dog?
How much does an aircooled vw engine weigh?
What are organisation management and technology dimensions of information systems?
How many miles from Houston TX to Franklin TN?
What is the correct spelling for Best friend?
What is weight of pressure treated 12 x 12 piling?
Why are my tomato plant leaves drooping and curling?
What is the process that produces starch from the leaves?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.