0
What else can I help you with?
Related Questions
Where are aeroplanes made in?
It depends what you mean be "made" If you mean designed:aeroplanes are made all over the word If you mean produced:areoplanes are mainly made in America, Russia and China but are made all over the world as well,
How do you spell made?
You could mean "made" as in: I made a mess. You could mean "maid" as in: The maid cleaned up the mess.
What does manmade mean?
made by mannot by machinery.
What does kenyadia mean?
It mean beautiful and wonderfully made!
Does synthetic mean man made?
man made
What does synthetically made mean?
It means man-made.
When were LEGOs sold?
i dont know what you mean by that but i think you mean what year they were made. legos were made in 1953
What word mean journey made by water is a?
It mean voyage
What does magnify mean?
Made bigger.
When was The Violanta made?
If you mean the Korngold opera., it was made in 1916.
What are Corvettes made of?
The bodies, if that's what you mean, are made of fiberglass.
What do you made my day really mean?
you surprised me or made me happy
Trending Questions
Can you plug in a mouse and a keyboard into PlayStation 3 and play?
What is 31.6227766 rounded to the nearest thousandth?
What is ICT Health and Safety?
Did Victorian era kids play pin the tail on the donkey?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
If you miscarry how long will it take before a pregnancy test shows up negative?
Car is jerking?
Why do people tease blonde girls?
How long can beer grain be stored and still be good for brewing?
What is the ratio of the number of vowels to the number of consonants in the English alphabet?
Will amtrak take me from Miami to Saint Augustine fl?
You just accidentally took a swig of rubbing alcohol thinking it was water in a glass will a swig be cause for medical attention?
What is the purpose of the active directory sites and services console?
Where can I find a summary for the poem A Banished Wife's Complaint?
Why do people shake hand with their right instead of left hand?
Can bear kill people?
Does common have children with eryka badu?
How do you get a Dark Crystal in Maple story?
Can you take Wellbutrin and bisoprolol together?
Why is a thrust stage good?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.