Tags French Language and Culture

Animals & Plants Arts & Entertainment Auto Beauty & Health Books and Literature Business Electronics Engineering & Technology Food & Drink History Hobbies Jobs & Education Law & Government Math People & Society Science Social Studies Sports Travel & Places

0

What does la photo mean in french?

Updated: 8/20/2019

Wiki User

∙ 11y ago

Best Answer

PHOTO as in picture/photograph

Wiki User

∙ 11y ago

This answer is:

Add your answer:

Earn +20 pts

Q: What does la photo mean in french?

Write your answer...

Submit

Still have questions?

imp

Related questions

What is 'Qui est sur la photo' when translated from French to English?

Qui est sur la photo? in French means "Who is in the photo?" in English.

Is the word photo masculine of feminine in french?

The word "photo" is feminine in French.

Is 'photo' in French feminine or masculine?

La photo ("the photo") is feminine in French.

Does amoi mean photo in french?

no. Photo is the same in French and English

How do you say thank you for allowing the picture in french?

Merci pour autoriser la photo. Merci pour permettre la photo.

What does quien es la de la foto mean in eng?

Whose is the photo? Who is the girl from the photo?

How do you say practice photography in french?

faire de la photographie, pratiquer la photo

How do you say The picture is art in French?

la photo c'est de l'art

What does miren la foto mean?

look at the photo

What does sur ta pictur t la quel mean in french?

"Sur ta pictur t la quel" is txt language. A French person would say "sur ta photo, tu es laquelle?" which means "on your picture, which one are you?"

What does la semaine mean in french?

"La semaine" means "the week" in French.

What does the French saying 'la classe' mean?

"La classe" is French for "class"

Trending Questions

What level does tyranitar learn earthquake? Which doctor treats glandular disorders? What actors and actresses appeared in Wash Away My Sin - 2013? How many people hate ant and dec? If your heart is the same size of your fist then what is the size of an elephants heart? Why were flip flops made? What kinds of enemies does a great white shark have? What are the release dates for Grayson and Reese Salesman Reese - 2013? Where did the term hoodie originate? What office creates a long-term report that sets levels of expenditures and revenue? What is easysuite? What were the people who stood in the pit to watch a play called? How long does it take to drive from Dearborn Heights Michigan to Brooklyn New York? Can you drink alcohol if you are taking naproxen? What is the difference between copying and moving files and folders? What is objectives driven project? How do you write 3.25 million in digits? Can the humans choose for themselves? What is a device called? What is the DNA replication strand for ATGCATTGACGGTACCGATACATCAT?

Still have questions?

imp

Previously Viewed

What does la photo mean in french?

Resources

Top Categories

Product

Company

Copyright ©2024 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.