answersLogoWhite

0

What has the author Benjamin Linfoot written?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Benjamin Linfoot has written:

'Architectural picture making with pen & ink' -- subject(s): Architectural drawing

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When did Edward Linfoot die?

Edward Linfoot died on 1982-10-14.


When was Edward Linfoot born?

Edward Linfoot was born on 1905-06-08.


When was Dan Linfoot born?

Dan Linfoot was born on 1988-07-08.


What has the author Benjamin Franz written?

Benjamin Franz has written: 'Valkanday'


What has the author Craig Benjamin written?

Craig Benjamin has written: 'The Yuezhi'


What has the author BENJAMIN ZACHARIAH written?

BENJAMIN ZACHARIAH has written: 'NEHRU'


What has the author Benjamin Cook written?

Benjamin Cook has written: 'Doctor Who'


What has the author BENJAMIN HALLIGAN written?

BENJAMIN HALLIGAN has written: 'MICHAEL REEVES'


What has the author Benjamin A Franklin written?

Benjamin A. Franklin has written: 'Experiences in efficiency'


What has the author Benjamin Schmolck written?

Benjamin Schmolck has written: 'Geistliche Lieder'


What has the author Benjamin H Craig written?

Benjamin H. Craig has written: 'Was she'


What has the author Benjamin Sinton written?

Benjamin Sinton has written: 'Poetical themes'

Trending Questions
Where is the Ferrari car manufactured? Why are my lifters tapping after flood water was drained from the engine and the oil has been changed? What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT? Did Alexander Fleming do bad? What is the meaning of game over? What is 390.98 rounded to the nearest square meter? What are intercalated disks? Why do you think graphs are a useful way to display information? Who is lyasan utyasheva? What objects in outer space can hit earth and cause major damage to earth? Why do Tamils wear dhotis? How much is yu gi oh card number 39 utopia worth? How much should you feed your 30 lb dog? How much does an aircooled vw engine weigh? What are organisation management and technology dimensions of information systems? How many miles from Houston TX to Franklin TN? What is the correct spelling for Best friend? What is weight of pressure treated 12 x 12 piling? Why are my tomato plant leaves drooping and curling? What is the process that produces starch from the leaves?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.