0
E. V. Lindstrom has written:
'Whittier and Richard Nixon'
What else can I help you with?
Related Questions
What has the author E V Belova written?
E. V. Belova has written: 'English'
What has the author V E Ford written?
V. E. Ford has written: 'The seashore'
What has the author E V Timms written?
E. V. Timms has written: 'Far Caravan'
What has the author V E Cotton written?
V. E. Cotton has written: 'The story of Liverpool'
What has the author V E Yarsley written?
V E. Yarsley has written: 'Cellulosic plastics'
What has the author V E Morgan written?
V E. Morgan has written: 'A history of money'
What has the author E S V W written?
E. S. V. W. has written: 'Column'
What has the author V E Sankov written?
V. E. Sankov has written: 'U istokov aviatsii'
What has the author E V Kirillina written?
E. V. Kirillina has written: 'Repin v \\' -- subject(s): Biography, Painters
What has the author E V Pomerantseva written?
E V. Pomerantseva has written: 'Russkoe narodnoe poeticheskoe tvorchestvo'
What has the author E V Prikazchikova written?
E. V Prikazchikova has written: 'Ekonomicheskie vzgliady A.N. Radishcheva'
What has the author E F V written?
E. F. V. has written: 'Spode porcelains and Japanese prints'
Trending Questions
What are the names of the bishop family children in minute to win it?
What is the value of m?
Why did unionists oppose sunningdale agreement?
What is the complementary sequence for atgcccgggtgtcgtagttga?
What percentage of 600 is 100?
What are some recommended foods to eat to relieve constipation?
How do you punctuate initials?
How much is a Louis vuitton bag serial number LM92372?
What are the isolation and lock-off procedures or permit-to-work procedure that applies to the equipment being installed or commissioned?
Describe two members of the ten Boom's secret family?
What human actions have contributed to the black ferret being endangered?
Why is all lava not the same?
What is the compound name of MoI2?
Why doctors in UK always prescribe you paracetamol whatever the sickness is?
How can i retrieve my ID number in Alfursan?
What are the characteristics of a folksong?
How will an el nino affect Jacksonville fl?
How long does it take to drive from Surrey BC to Calgary Alberta?
What is the oil capacity of a 1994 Mustang 3.8 Liter 6 cylinder?
What is a disadvantages DOL or direct online starter?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.