answersLogoWhite

0

What has the author Erika T Lin written?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Erika T. Lin has written:

'Shakespeare and the materiality of performance' -- subject(s): Theater and society, Stage history, Theater audiences, History

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

What has the author T A O'Connor written?

T. A. O'Connor has written: '\\'


What has the author T T Mboweni written?

T. T. Mboweni has written: 'Governor's address'


What is T. Y. Lin's birthday?

T. Y. Lin was born on November 14, 1912.


When was T. Y. Lin born?

T. Y. Lin was born on November 14, 1912.


When was T. Y. Lin International created?

T. Y. Lin International was created in 1954.


What has the author I T Grichenko written?

I. T. Grichenko has written: 'Podvig'


What has the author I T Ogorodnikov written?

I. T. Ogorodnikov has written: 'Pedagogika'


What has the author T Kerashev written?

T. Kerashev has written: 'Izbrannoe'


What has the author T I Awagu written?

T. I. Awagu has written: 'Scrap'


What has the author T Vaaskivi written?

T. Vaaskivi has written: 'Yksinvaltias'


What has the author I-T Vaizgantas written?

I.-T Vaizgantas has written: 'Rastai'


What has the author T Disch written?

T. Disch has written: 'Burn this'

Trending Questions
Where should a seven branched menorah be placed? Misprint you have a quarter and on the back it says Northern Mariana islands is that a misprint? Remove the front door speaker landcruiser? How high did sputnik go up? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? Which describes an aspect of total war as it was practiced during the Civil War? What is the Irish Gaelic for 'fire earth metal water and wood'? How can cactus be more useful than a rose? What do governments do to stabilize the economy? What are the harmul affects oxycodeine? What is 10 percent of 650000? Can you use frozen vegetables that have thawed? How do you get a Disney copyright permission? How do you round 735901 to nearest hundred thousand? What is the 2013 murder capital? What maths do you need to know to become an electrician? Calculate heat of fusion? Why some of the word use ed at the end of a word? Can cocci bacteria be found in animals? Timely filing limit for blue cross in Texas?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.