0

What has the author Hermann Reich written?

Anonymous

∙ 11y ago

Updated: 8/21/2019

Hermann Reich has written:

'The home of the puppet-play' -- subject(s): Book reviews, German Puppet plays

Wiki User

∙ 11y ago

What else can I help you with?

Related Questions

What has the author Hermann Scherer written?

Hermann. Scherer has written: 'Hermann Scherer'

What has the author Hermann Poll written?

Hermann Poll has written: 'Hermann Poll'

What has the author Hermann Stamm written?

Hermann Stamm has written: 'Hermann Stamm'

What has the author Hermann Ratjen written?

Hermann Ratjen has written: 'Hermann Ratjen'

What has the author Lucian Reich written?

Lucian Reich has written: 'Lucian Reich' -- subject(s): Exhibitions

What has the author Peter A Reich written?

Peter A. Reich has written: 'The English auxiliaries'

What has the author C Reich written?

C. Reich has written: 'Greening of America'

What has the author Stefanie Reich written?

Stefanie Reich has written: 'Carbon nanotubes'

What has the author Hermann Kaulbach written?

Hermann Kaulbach has written: 'Bilderbuch'

What has the author Hermann Rittweger written?

Hermann Rittweger has written: 'Offsettechnik'

What has the author Hermann Urbanner written?

Hermann Urbanner has written: 'Kramsach'

What has the author Hermann Winds written?

Hermann Winds has written: 'Elektrisch'

Trending Questions

What is the full form for SHEM? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? How does jem try to make scout feel beter after he conversation with aunt alex andra? How much does an ounce of lawrencium cost? What is ducktape for? Who is martinique president? What red gemstones can one have set in a ring? What muscles are used doing the splits starting from standing? What is the land area from which a stream gets water? What is it like at Mecca? Why does Douglass believe that people should be allowed to move freely from one country to another? How do you use boilerplates? What does the idiom 'In black and white' mean? How do you put aerobe in a sentence? What is the cost for a valve job on a 1999 GMC suburban? Why do AC lines freeze up and how can this issue be prevented? How many credits will FAFSA pay for? Is France a European country? What is the Japanese word for rabbit? In badmintion what is a powerful downward stroke?

Resources

Top Categories

Product

Company

Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.