0
What else can I help you with?
Related Questions
What is Suzanne Lilar's birthday?
Suzanne Lilar was born on May 21, 1901.
When was Suzanne Lilar born?
Suzanne Lilar was born on May 21, 1901.
When did Suzanne Lilar die?
Suzanne Lilar died on December 12, 1992 at the age of 91.
What has the author S Lilar written?
S. Lilar has written: 'Aspects of love'
How old was Suzanne Lilar at death?
Suzanne Lilar died on December 12, 1992 at the age of 91.
How old is Suzanne Lilar?
Suzanne Lilar was born on May 21, 1901 and died on December 12, 1992. Suzanne Lilar would have been 91 years old at the time of death or 114 years old today.
What has the author Suzanne Marcil written?
Suzanne Marcil has written: 'Vestiges'
What has the author Suzanne Paola written?
Suzanne Paola has written: 'Petitioner'
What has the author Suzanne Myre written?
Suzanne Myre has written: 'Peignoir'
What has the author Suzanne McClelland written?
Suzanne McClelland has written: 'Suzanne McClelland, intersections and interruptions'
What has the author Suzanne Caporeal written?
Suzanne Caporeal has written: 'Suzanne Caporeal' -- subject(s): Exhibitions
What has the author Suzanne Martinon written?
Suzanne Martinon has written: 'Nous deux'
Trending Questions
How much are kx85 dirt bikes?
What is the greatest common divisor of 45 60?
What are some Animal Jam Club Websites?
How much is in 2 gal 3 qt converted to in qt?
Who is the honor of apple company?
The name of the first space program that was dedicated to putting a man on the moon was?
Old Testament brother of Moses?
Are there any family alive of James dean?
Why was Rutherford Hayes called the dark horse candidate?
What has the author Henryk Hoffmann written?
How do I round 678537299 to the nearest tenth of a million?
What Channel number is tsn on shaw?
How effective is kwik wood for repairing damaged furniture?
What is the top speed of a 1997 Crown Victoria?
What is the equation for the word problem Micheal has 4 feet of yarn . if the yarn is cut in to 13 foot long pieces how many peeces will Micheal have?
What is the song in weeds season 6 that goes like a lollipop in a candy shop on a steamy summer's day?
Who makes Kenmore cook-tops?
How many cups is 1.67 ounces?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Where is the original wcw us belt at?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.