answersLogoWhite

0

What has the author Zhi Wu written?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Zhi Wu has written:

'Zi hen hong chou'

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

What has the author Delin Wu written?

Delin Wu has written: 'Guangdong zhi wu zhi' -- subject(s): Plants


What has the author Zhi Jian Wu written?

Zhi Jian Wu has written: 'Fu zhi dong wu zhi mi' 'Xue xi yu da nao'


What has the author Dequan Dai written?

Dequan Dai has written: 'Nanzhuang zhi wu zhi'


What has the author Jiangling Wu written?

Jiangling Wu has written: 'Du shu zhi dao'


What has the author Shiyuan He written?

Shiyuan He has written: 'Beijing zhi wu zhi =' -- subject(s): Plants


What has the author Yunteng Wu written?

Yunteng Wu has written: 'Yesu shi zong zhi mi'


What has the author Meifeng Wu written?

Meifeng Wu has written: 'Xing zhi yu liu bian'


What has the author Guozheng Zhou written?

Guozheng Zhou has written: 'Wu zhi, zhi liang he zhong liang'


What has the author Songgao Wu written?

Songgao Wu has written: 'Zhi wai fa quan' -- subject(s): Exterritoriality


What has the author Fadong Wu written?

Fadong Wu has written: 'Wujiaoteng zhi Lizhiwo =' -- subject(s): Geoparks, Guidebooks


What has the author Fangji Wu written?

Fangji Wu has written: 'Zhen jiu qu xue zheng zhi can kao shou ce'


What has the author Wu Shu written?

Wu Shu has written: 'Shu Wu zhi Hu Feng shu xin quan bian' -- subject(s): Correspondence

Trending Questions
What is the full form for SHEM? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? How does jem try to make scout feel beter after he conversation with aunt alex andra? How much does an ounce of lawrencium cost? What is ducktape for? Who is martinique president? What red gemstones can one have set in a ring? What muscles are used doing the splits starting from standing? What is the land area from which a stream gets water? What is it like at Mecca? Why does Douglass believe that people should be allowed to move freely from one country to another? How do you use boilerplates? What does the idiom 'In black and white' mean? How do you put aerobe in a sentence? What is the cost for a valve job on a 1999 GMC suburban? Why do AC lines freeze up and how can this issue be prevented? How many credits will FAFSA pay for? Is France a European country? What is the Japanese word for rabbit? In badmintion what is a powerful downward stroke?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.