answersLogoWhite

0

What is Breaking Benjamin?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/17/2019

one of the coolest leading rock bands in AMERICA

an almost good band

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

When was Breaking Benjamin created?

Breaking Benjamin was created in 1998.


How old is Breaking Benjamin?

The band 'Breaking Benjamin' was created in 1998.


Who is more famous Lady Gaga or Breaking Benjamin?

Breaking Benjamin


Is the band 'Breaking Benjamin' Canadian?

No. Breaking Benjamin is from the United States.


Is the band 'Breaking Benjamin' Irish?

No, Breaking Benjamin is from Pennsylvania, USA.


What are the lyrics to 'Get Connected' by Breaking Benjamin?

There isn't a song with that title by Breaking Benjamin.


Who is Aaron Fink from Breaking Benjamin?

Aaron Fink plays the guitar from Breaking Benjamin.


When was the band 'Breaking Benjamin' formed?

Breaking Benjamin was formed in 1998 by vocalist Benjamin Burnley and drummer Jeremy Hummel.


What drums does Breaking Benjamin use?

Breaking Benjamin uses Yamaha Drums, and Zildjian Cymbals.


Why is the band 'Breaking Benjamin' famous?

Breaking Benjamin is famous because people enjoy their music.


How long has breaking Benjamin been around?

Breaking Benjamin has been around since 1998.


Does Breaking Benjamin sing the 2009 song Disappear?

No, Breaking Benjamin does not have a song titled 'Disappear'.

Trending Questions
Is the gogli aperatus the same thing as the gogli complex? How many tens are there in 220? What is a famous quote of baron von stuebon? If a guy you like gives you a back rub does this mean he like you? What is a good love song for a forty-fifth wedding anniversary? What day of the week was June 11 1975? The body of water east of the Everett Mountains and on Baffin Island? How do you know what mate is the right one for you? When uranium-238 is transformed into thorium-234 it is represented by a balanced equation What is missing from the equation of U-238 undergoing radioactive decay? What is the zip code for Wisconsin Rapids Wisconsin? How much are Pro dancers supposed to weigh? What is the formula for matter? What inspired Natalie babbitt to begin write stories? How can conditioned beer be properly stored to maintain its quality and flavor? What nicknames does Richard Denson go by? He supported a national bank and protective tariffs? What is the weight of a sheep's heart? What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa? What are the practical implications of a material having a low modulus of elasticity? What role does cell division play with a starfish?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.