answersLogoWhite

0

What is Chris Morrissey's birthday?

User Avatar

Anonymous

∙ 15y ago
Updated: 8/18/2019

Chris Morrissey was born on August 15, 1972.

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

What is the name of morrisseys debut solo album?

Viva Hate which he released in 1988.


When is Chris Brown'ss birthday?

Chris Brown's birthday is May 5.


When is Chris Faller's from The Hush Sound birthday?

Chris Faller's birthday is May 1, 1985.


Chris Browns bday?

Chris Brown's birthday is on May 5. He was born in 1989.


When is Chris d'lacey's birthday?

Chris d'Laceys birthday is on the 16th of December. He was born on the 16th of December, 1954.


When is Chris webby's birthday?

His birthday is January 23


When is Chris Brown birthday?

Chris Brown was born on May 5, 1989


What day is the birthday of Framing Hanley's band member Chris Vest?

Chris Vest's Birthday is July 1st.


When Dr. Chris Brown birthday?

Chris Brown (RnB singer) birthday is on may 5th born 1989.


What did Chris McCandless give his father for his birthday?

Chris McCandless gave his father a new car for his birthday.


When is chris's birthday?

Chris Brown was born May 5, 1989.


When is chris Jericho birthday?

y2j's birthday is at nov 21 1970

Trending Questions
How many votes would a candidate have to have to be elected if the total of electoral votes was 91? Is Melissa Gilbert separated from Bruce Boxleitner? Why did plantation owners switch from indentured servitude to black slavery? What are the applications of continuity in real life? Who carried the ark of the covenant? When was Myrlin Hermes born? Why is King James referred to as dread Sovereign? What movie and television projects has Sharon McHenryPower been in? What has the author Gene Wunderlich written? What was Hitlers term for his long-term program for the Jews? What is the difference between probability and actuality? A surf board moves at 5 m per s on the crest of a wave. The distance between wave crests is 10 m. What is the frequency of the wave motion? How do you unlock an SD card? When a Pearson consumes less food than is required to meet body needs glycogen is converted into proteien? Is a key an insolator? Where can you find designer kids clothes? What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta? Salmon scientific name? How many calories in a tablespoon of raisins and peanuts? Who was the greatest ruler in early Medieval Europe after the fall of Rome?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.