answersLogoWhite

0

What is Chuck Berry's name?

User Avatar

Anonymous

∙ 12y ago
Updated: 1/3/2023

His full name is... Charles Edward Anderson Berry.

User Avatar

Jude Beatty ∙

Lvl 10
∙ 3y ago
Copy

What else can I help you with?

Related Questions

What is chuck berrys full name?

His full name is... Charles Edward Anderson Berry.


What Music Was Inspired by Chuck Berrys Music?

beatlemania


Chuck berrys fist hit single?

Sweet Little Sixteen


What was chuck berrys first wifes name?

Chuck Berry's first wife's name was Raynard. They married in 1948 and remained together until their divorce in 1973. Raynard was a significant part of Berry's life during the early years of his music career.


What was chuck berrys first hit song?

Maybelline-August 1955


Did the rolling stones ever record chuck berrys nadine?

I don't believe they did. However, Keith Richards played it with Chuck Berry in "Hail Hail Rock and Roll." There's a live clip on YouTube.


When was Brookefield of the Berrys created?

Brookefield of the Berrys was created in 1840.


When was Berrys Coaches created?

Berrys Coaches was created in 1920.


When is berrys birthday from Pokemon?

His name is actually spelled Barry, His birthday is August 15th


What is the birth name of Chuck Skull?

Chuck Skull's birth name is Chuck Skull Sibaja.


What is the birth name of Chuck Vinson?

Chuck Vinson's birth name is Chuck Rallen Vinson.


What is the birth name of Kenneth Chuck?

Kenneth Chuck's birth name is Man Hing Chuck.

Trending Questions
Calculate the molarity of a H3PO4 solution of 6.66 in 555mL of solution? What are treatments for splenic trauma? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc? Does logh mean forgive in Gaelic? What is the collect noun for tools? Are phoenix university credits transferable? Where is the Unitarian Universalist Church located? How much solar energy reaches Earth? What is a female monk called in the Chinese language? Which theme can be found in both If and The Jungle Book by Rudyard Kipling? Where is the habitat of Rhizomes? How much are ballet point shoes at a dance school? Is 0.323232 rational? What did George Washington say? What steps can use to protect yourself from cybercrime? The three states of matter are? Is the setting in England for James and the Giant Peach? Was Australia called Australia in 1901? Sleepover games for 18 year olds? What is the denominator of fraction?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.