answersLogoWhite

0

What is I'm in love with Levi in German?

User Avatar

Anonymous

∙ 15y ago
Updated: 8/18/2019

Ich bin verliebt in Levi.

User Avatar

Wiki User

∙ 15y ago
Copy

What else can I help you with?

Related Questions

How do you say Levi in German?

Levi (but it's pronounced LEE-VEE)


What is Levi Strauss' nationality?

Levi Strauss's nationality is American (of German decent)


What axcent did Levi Strauss have?

a German one


How do you say you love Levi in Spanish?

te amo Levi


What German immigrant created Levi jeans for the California miners?

Levi Strauss was the one who created them


German immigrant who made clothing?

Levi Strauss


Does Levi like boys?

Levi love boys he tried to hump me last weekend.


What is im in German?

I am in German is Ich bin.The German word im is a contraction of in dem which translates as in the.


What nationality is levy?

Levi Strauss's nationality is American (of German decent)


What country or city did Levi Strauss come from?

Germany- Strauss a German name


What is Levi Strauss's full name?

His full German name was Löb Strauß.


What is Levi strauss full name?

Levi Strauss' full name was actually Löb Strauß. He later changed his name to Levi Strauss when he immigrated to the United States.

Trending Questions
Is the cat deity Aelurus Greek or Egyptian? What is 906060 in scientific notation? How many alleles do people have for their charcteristics? What does delimit mean? What is that clack noise in front whees on Honda Element? How much does a standard window weigh? What is the gram stain reaction of strep throat? Where was the earthquake that reached 9.5? Skull and crossbones flag what bones are crossed? Does drinking alchool have any eFfects on. The pregnancy? What clothing did women and children wear in the gold rush period? Where would you go if you wanted to see a stalactite? What should I do if my gear shift cable broke? How does connective tissue adapt to its role? What is the probability of rolling a number less than 4 on a 6-sided number cube labeled 1-6? When is the new Percy Jackson book coming out? What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT? What is the difference between a fact and a statement? Why would the constitution not have been written without compromise? What are some of the services provided by First Hawaiian Bank online?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.