answersLogoWhite

0

What is Justin Bieber's holiday?

User Avatar

Anonymous

∙ 16y ago
Updated: 8/17/2019

His B-Day

User Avatar

Wiki User

∙ 16y ago
Copy

What else can I help you with?

Related Questions

Who is Justin Biebers mannager?

Justin biebers manger is scooter braun


Can you be Justin Biebers girlfriend this 2011?

no i cant be Justin Biebers girlfriend because, I am Justin Beiber.


What was Justin Biebers CD called?

Justin biebers CD is called my world


Where was Justin biebers first holiday?

MARCH 1'st 1994 was Justin biebers first holiday it was his birthday i just want to say i love u Justin i want to meet u in person :);)i love ur songs and im a big fan ofu and selena u are great and i just want to say that so u can here that u probably herd tHAT Alot


What is Justin Biebers favourite boys name?

Justin and biebers


What is Justin Biebers date of berth?

Justin Biebers date of birth is March 1,1994


Is justin biebers perfume called someday?

yes! im 1 of Justin biebers fans go Justin bieber:)


What is the name of justin biebers new fragrance?

Justin Biebers new fragrance is called Someday.


Is Justin Biebers mom in jail?

Did Justin Biebers mum go too jail? no


Is Justin Biebers mentor Justin Timberlake?

No


What is Justin Biebers ipod?

i can't answer that what does that question mean i have an i-pod does that mean i'ts Justin biebers iPod


What is Justin Biebers creativity?

I think Justin Biebers creativity comes from his heart unlike most singers

Trending Questions
How do i clean glue from a melted mouse trap i left in my oven? Why don't chicken eggs contain vitamin c? What famous speech was made in the summer of 1963 in Washington dc? Is it ok to have a fire pit over asphalt? Is The opposite angles of a parallelogram are congruent? Pinfire damascus barreled shotgun with the inscription Christoph Funk in Suhl Looking for info on gun or the maker? Is 4 decimeters bigger than 4 meters? Why are the risks of giving birth to an 8 months old premature baby? Is Gareth David-Lloyd married? How long do you cook a turkey meatloaf? What would happen to this strand of DNA during transcription tacgcgcattgtcgtctaggtttcgatatattagctacg? How to trade commodities online securely? Can you tell if you are pregnant after two weeks without taking a pregnancy test? Why are penguins possessive with their partners just like humans? When should a mare start to get milk? Can you tax tea? What is the LCM of 5 25 100? What is the distributive property of 127 and 32? Where is the Sheppard Air Force Base Heritage Foundation in Wichita Falls Texas located? How much is a modified exhaust ticket in Louisiana?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.