answersLogoWhite

0

What is Miranda Cosgroves fave color?

User Avatar

Anonymous

∙ 16y ago
Updated: 8/17/2019

her fave color is purple

User Avatar

Wiki User

∙ 16y ago
Copy

What else can I help you with?

Related Questions

What is Miranda Cosgroves nail color?

red


What is Miranda Cosgroves faverout color?

Miranda Cosgroves favorite color is either red orange yellow green blue purple or any other color if you see her ask her.


What is Miranda Cosgroves hair colour?

Her hair color is brown.


What is Miranda Cosgroves fav color?

purple & for makeup pink & white


What are Miranda Cosgroves measurements?

Miranda Cosgroves 2012 measurements 32b-23waist-28hips


What color is Miranda Cosgroves hair?

fake lite brown she is so fake its not even funny


What is Miranda cosgroves weemee?

Miranda cosgrove does not have a weemee they are posers


Who is cosgrove?

Miranda Cosgroves Cousin


What is Miranda Cosgroves kik?

PersonPeople


Who is Miranda Cosgroves father?

Tom Cosgrove


Where are Miranda Cosgroves parents from?

Texas and flordia


Miranda Cosgroves aim?

She doesn't have AIM.

Trending Questions
Should I have my car wrapped? Why does light have a dual wave particle model? What does the carrying of seeds to a new place? What was F. Scott Fitzgerald's daughter's name? What is the lecithin daily intake? What did suyuan woo tell an-mei when an-mei prepared for her trip to china? What cranial nerve is used for pupillary constriction? Can you use August in a sentence please? How many electrons in one columb? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? What is the significance of the spiritual rosary in the practice of prayer and meditation? How many votes does each state have in the electorial college? What is the closest airport to Osage Beach MO? How do you remove center console from 2004 Hyundai xg350? Is the Grand National cruel? What are symptoms of chiari malformation? What is the most poinsonous land snake? How do you integrate e powerintegral2x-1? Deciduous trees are those that? What is the US Mining Law of 1812?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.