0
What else can I help you with?
Related Questions
What is Thea Gilmore's birthday?
Thea Gilmore was born on November 25, 1979.
What is Thea Gill's birthday?
Thea Gill was born on April 5, 1970.
What is Thea Dorn's birthday?
Thea Dorn was born on July 23, 1970.
What is Thea von Harbou's birthday?
Thea von Harbou was born on December 27, 1888.
Who is rick astleys dad?
Max butter
What color are rick astleys eyes?
Brown.
What are the release dates for Thea - 1993 Birthday Girl 1-8?
Thea - 1993 Birthday Girl 1-8 was released on: USA: 3 November 1993
Name rick astleys new single?
Lights Out
What is the birth name of Thea Samuelson?
Thea Samuelson's birth name is Thea Connors.
What is the birth name of Thea Gottschalk?
Thea Gottschalk's birth name is Thea Hauer.
What is the birth name of Thea Holme?
Thea Holme's birth name is Thea Johnston.
How tall is Thea Constantine?
Thea Cantell is 5' 8".
Trending Questions
Can you drip a little colostrum out of your nipple 5 years later?
What is the role of Charlotte at the Charlotte's web?
What are the complementary bases for the following DNA strand aatggccttagcagttgcatga?
How do you say waiting room in Spanish?
What colors do you mix to get light purple?
What are the integers between 2 and 8?
What did Gary paulsen do when at the circus?
How do you make a collage on save trees?
What western power dominated your country?
What are chords on a guitar and how are they played?
What type of service does Bullguard Internet Security provide?
What words start with the letters ew?
Nervous system function?
Did Toyota Avalon 1998 came in 4 cylinder?
Is spice THC?
Atmospheric pressure is the pressure exerted by the atmosphere against the of the earth?
Why does 94 ford ranger your engine have no power?
Would the thoracic duct drain the upper left part of the body?
What is a electronic device that is made of solid mateiral which electrons move through?
How cold to freeze a Snickers bar?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.