answersLogoWhite

0

What is a blitzar?

User Avatar

Bobo192 ∙

Lvl 1
∙ 9y ago
Updated: 8/21/2019

A blitzar is another term for a fast radio burst, or the phenomenon which emits such a burst.

User Avatar

Wiki User

∙ 9y ago
Copy

What else can I help you with?

Related Questions
Trending Questions
What do you call the separate grain from straw? How much gunpowder did Guy Falks use? Does Selena Gomez live with her step brother and step sister? When was Aimé Haegeman born? What is the average stair rise measurement in residential buildings? Why does the optic nerve cause the blind spot? How does anorexia and bulimia affect Guatemala? Is buddy used for both boy and girl? Why does your ford E350 van destroy serpentine belts? What are the slang words benefits? I was a jazz pianist and composer who often played at Harlem's cotton club? What is the mRNA strand for ggctatatcctgcgctatacgcta? How many centuries equal a Millennium? Discuss the importance of marketing research for non profit organization? How long is the flight from Tokyo to cebu? 1 over 4 divided by 1 over 6? How do you do algebra 1-unit 5 test? What is the term for a genetic condition where both alleles for a particular trait are different from each other? Which conquistadores helped destroy the Inca? What was the name taken by 13 popes?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.