0
What else can I help you with?
Related Questions
What is a famale donkey called?
Called a Jenny
What is a famale penguin called?
a penguina
What do you called famale and male giraffes?
A male giraffe is called a bull
What famale elephant called?
A female elephant is called a cow and a male elephant is called a bull. A baby is called a calf.
What is a pre-swan called?
If you mean a young swan, it's called a cygnet
What do you called a baby swan?
A baby swan is called a cygnet.
Female swan called?
A female swan is called a "pen"
What is called of a younger swan?
A baby swan is called a "sygnet"
What is called female swan?
A female swan is called a Pen.
What is a young swan called?
A young swan is called a cygnet or flapper
What is a male swan called?
A male swan is called a cob.
How far does famale cat go into heat?
How far does a famale cat go onto heat
Trending Questions
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
How can you open account in NCB ksa?
Which medical imaging technique depends on the use of xrays moving in an arc around the body producing a cross sectional image?
Where does most of the work for a presentation take place?
Is owning a landscaping company profitable?
What were the most common girl names in the 1700s?
What is additional property?
Who has hosted SNL the most?
Where does all life come from if spontaneous generation is false?
What qualifications do you have?
What is 15C in F?
Hydrogen-powered cars create less pollution than gasoline-powered cars when driven. What might be a challenge to using hydrogen as a fuel?
What do castles normally have?
How do histamine 11 blockers affect the body?
How do you code a key for a 1993 Ford Ranger?
How many syllables vitamin has?
When using Charles law the units of temperature can be either Kelvin or degree Celsius?
What is harbor of Rio de Janeiro?
How many people work for amazon?
Where does the vacuum line go from heat control valve?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.