0
What else can I help you with?
Related Questions
What word means a surprise attack?
Ambush.
What is a word that means verbally attack?
The word is "berate," which means to scold or criticize someone harshly.
What is a word that means to surround and attack a city?
siege
What word means a quick surprise attack?
Ambush.
Three letter word that means attack?
hit
What is a word for military invasion?
The word is incursion. It means a sudden invasion or attack.
What vocabulary word means if you attack us we will attack you with everything that we have?
Retaliation means if you attack us we will attack you with everything that we have (and more). A retaliatory strike would mean the same thing.
What four letter word means sudden attack?
raid
What word means to attack often with artillery?
To bombard, I believe.
Which word is an adjective that means most likely to attack?
aggressive
Is attack a common noun?
No because a compound word is made when two words are joined to form a new word. Attack might have at and tack. All compound words must have two words and no remaining letters. Attack doesn't have any but it is not a compound word.
A four letter word that means a short quick attack?
stab
Trending Questions
Does hot water get colder faster than cold water?
Who was the artist singing Mr Bojangles in the Soloist?
A barker is most likely to work where?
What are the first 40 prime numbers?
Is there any information on the 1924 gas explosion in Manville Rhode Island?
How do you finish off a persuasive speech?
What is the original name of Edinburgh?
What has the author Amazile de Hollanda Vieira written?
What does unauthorized access mean?
What is the name of the international airport in Guyana?
What does the m in m16 stand for?
What is another word for smirk?
Can the tax assessor legally enter my property?
Where can one download free wiring diagrams auto mate am2 key less entry Suzuki?
What are the top attractions to visit on Indonesia tours?
Is tilex toxic?
Where is the temp sensor on a vw golf mk3?
When first fall asleep enter into?
How do mountain lions ensure having food for days after a kill?
What is the DNA sequence that is complementary to DNA strands of CGGCCTTCAATAGGTCCCAAA?
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.