answersLogoWhite

0

What is another word for thin that starts with the letter p?

User Avatar

Anonymous

∙ 7y ago
Updated: 8/21/2019

pole

User Avatar

Wiki User

∙ 7y ago
Copy

What else can I help you with?

Related Questions

What is another word for thin that starts with the letter h?

This could be haggard.


What is another word for addition that starts with a n?

Another word for addition which starts with the letter N is New.


What is a word that starts with T and has the letter I as the third letter?

third thin, thimble, tried, trip...


What is another word for correspondence that starts with the letter L?

letter


What is another word for Water that starts with an O?

Another word for water that starts with the letter 'O' is oxygen dihydrogen.


Another word for informed that starts with the letter a?

updated


What is another word for amazing that starts with the letter A?

Astonishing.


Another word for on top that starts with the letter a?

Atop.


What is another word for market that starts with the letter a?

advertise


What is another word for astonishing that starts with the letter a?

Amazing


What is another word for label that starts with letter a?

astamp


Another word for speaker that starts with the letter O?

Orator is another word for speaker.

Trending Questions
Is the gogli aperatus the same thing as the gogli complex? How many tens are there in 220? What is a famous quote of baron von stuebon? If a guy you like gives you a back rub does this mean he like you? What is a good love song for a forty-fifth wedding anniversary? What day of the week was June 11 1975? The body of water east of the Everett Mountains and on Baffin Island? How do you know what mate is the right one for you? When uranium-238 is transformed into thorium-234 it is represented by a balanced equation What is missing from the equation of U-238 undergoing radioactive decay? What is the zip code for Wisconsin Rapids Wisconsin? How much are Pro dancers supposed to weigh? What is the formula for matter? What inspired Natalie babbitt to begin write stories? How can conditioned beer be properly stored to maintain its quality and flavor? What nicknames does Richard Denson go by? He supported a national bank and protective tariffs? What is the weight of a sheep's heart? What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa? What are the practical implications of a material having a low modulus of elasticity? What role does cell division play with a starfish?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.